Subject: Help with restricting protein binder design to specific RNA loop region

[m-Mueller-m]

Hi, thank you for this great work! It was very easy to set up and to generate initial backbone designs. I also really appreciate the usage examples provided.
I am currently struggling to restrict a protein design to bind a specific region of an RNA hairpin (specifically the loop). I have tried using contigmap.contigs and protein_rna_hotspot_res. I tried different ways of specifying both the contigs and the hotspot (or only the contigs) but it does not seem to restrict the binding site to the specified region.
The protein_rna_hotspot_res flag consistently causes errors, which is probably due to me not specifying the input in the right way.
Below is the command I am using:

apptainer run --nv .../SE3nv.sif .../run_inference.py \
--config-name=multi_polymer \
diffuser.T=100 \
inference.ckpt_path=.../train_session2024-07-08_1720455712_BFF_3.00.pt \
inference.num_designs=5 \
inference.input_pdb=.../ES31Lb.pdb \
inference.set_sequence=['A1-32:AAGCGCCCGUCCGCGCGCGCGGGCGGGCGCGA'] \
"contigmap.contigs=['32 100, A13-15']" \ #this runs but doesn't restrict binding
+protein_rna_hotspot_res=A14 \ #this causes errors, also tried to define atom from pdb file instead of residue or input as list, str etc
inference.update_seq_t=True \
diffuser.aa_decode_steps=40 \
contigmap.polymer_chains="['rna', 'protein']" \
inference.output_prefix=.../ES31_

I would appreciate any input on what I'm doing wrong here. Thanks a lot in advance!