Skip to content

Latest commit

 

History

History
501 lines (383 loc) · 35.4 KB

File metadata and controls

501 lines (383 loc) · 35.4 KB

On the design of CRISPR-based single cell molecular screens

This is a resource for the paper On the design of CRISPR-based single cell molecular screens, from the Shendure/Trapnell labs. The paper is available on the Nature Methods website here (also see free link to PDF).

We provide info on:

  • how to access reagents for CROP-seq for use with CRISPR or CRISPRi
  • how to perform enrichment PCR for CROP-seq experiments
  • how to use a few pieces of software we have developed to assign guide sequences (or any barcode sequence) to cells in CROP-seq assays or similar
  • how to download data from our paper
  • the complete set of scripts that we used for the analysis in the paper

Important Update

This repository attempts to capture in some detail what we think are likely to be the most generic steps in the workflow of a CROP-seq screen or similar. Downstream analysis is highly indivdual and likely to change over time so while we've included a larger set of scripts than are described in detail within the README for completeness, they are likely not the right starting point for your particular study.

(full disclosure, Andrew Hill works for 10x Genomics as of this writing) Since the completion of this project, 10x Genomics has also released both workflow and software features to make these sorts of screens easier (see product description). It includes a revised workflow that detects Pol-III guide transcripts directly rather than relying on a secondary Pol-II transcript. However, even if you are using CROP-seq or any other vector design, you should be able to utilize cellranger (primary software tool from 10x) to process your data -- see software docs page. The example feature-reference CSV file suggested for feature barcoding in the context of CRISPR screens is geared towards 10x's workflow, so if you are using a non-10x workflow like CROP-seq you may need to adjust the feature reference to use an appropriate pattern for the construct you are using. 10x support should be able to help with this if the necessary modifications are not obvious from the documentation linked above. cellranger will automate guide assignment and basic differential expression testing / QC and provide outputs in a covenient format with no extra steps. I would personally recommend this path rather than the one documented here for anyone starting out now.

Table of Contents

Reagents

See our paper for a full set of vectors from this study made available on addgene.

Likely of particular interest, we have made a version of the CROP-seq vector that has a grna-backbone that is optimized for CRISPRi (Addgene #106280).

If you use these reagents or software tools provided here, please cite:

Andrew J. Hill*, José L. McFaline-Figueroa*, Lea M. Starita, Molly J. Gasperini, Kenneth A. Matreyek, Jonathan Packer, Dana Jackson, Jay Shendure^, and Cole Trapnell^. 2018. “On the Design of CRISPR-Based Single-Cell Molecular Screens.” Nature Methods, February. https://doi.org/10.1038/nmeth.4604.

For all CRISPR (not CRISPRi) assays, we simply use the CROPseq-Guide-Puro vector (Addgene #86708) as provided by the Bock lab.

If you use CROP-seq and/or reagents from the Bock lab, please cite:

Paul Datlinger, André F Rendeiro*, Christian Schmidl*, Thomas Krausgruber, Peter Traxler, Johanna Klughammer, Linda C Schuster, Amelie Kuchler, Donat Alpar, Christoph Bock (2016). Pooled CRISPR screening with single-cell transcriptome readout. Nature Methods. DOI: 10.1038/nmeth.4177.

Enrichment PCR

We find that using targeted amplification (as done in Dixit and Adamson et al.) increases the rate of assignment in CROP-seq experiment by approximately two-fold.

Our amplifications were performed on full-length cDNA prior to shearing, but for CROP-seq amplification out post-sheared product may be fine with slightly different primers (not tested).

Importantly, our paper describes a protocol for 10X V1, but 10X currently cells their V2 product. We present both protocols below for CROP-seq.

Both protocols are nested PCRs where the first primer on one side is to an outer part of the U6 promoter on the first PCR and then an inner part of U6 on the second PCR (next to the guide sequence). We find this nesting helps, but protocols without nesting or with fewer steps may also be feasible. In all cases we monitor reactions on qPCR to avoid overcycling, which reduces the rate of chimeras that otherwise introduce low level noisy spurious guide assignments. While these are usually quite trivially excluded using simple threshold, our downstream scripts also detect and remove many chimeras using the UMI sequences.

10X V1 (what we did in the paper, but V1 no longer sold)

All PCR reactions were performed with a P7 reverse primer (as introduced by the 10X V1 oligo DT RT primer).

The forward primers for each reaction are listed below.

Reaction 1

TTTCCCATGATTCCTTCATATTTGC

primes to part of the U6 promoter.

Reaction 2

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-cTTGTGGAAAGGACGAAACAC

primes an inner portion of the U6 promoter adjacent to the guide sequence and adding the standard Nextera R1 primer.

Reaction 3

AATGATACGGCGACCACCGAGATCTACAC[8bp Index]TCGTCGGCAGCGTC

a nextera P5 index primer.

Each PCR was cleaned with a 1.0X Ampure XP cleanup and one microliter of a 1:5 dilution of the first PCR was carried forward and a 1:25 dilution of the second PCR was carried into the final PCR reaction. PCRs were monitored by qPCR and stopped just prior to reaching saturation to avoid overamplification. The final PCR was run on a Bioanalyzer to confirm expected product size.

10X V2 (what you would probably have to do)

WARNING: All datasets from our paper were 10X V1. Please note that while we have a protocol for V2 that we are fairly happy with, we have found some of the reactions to be a little finicky, so please keep that in mind. We may choose to optimize this protocol further and will update when we have more info. We have had good success with the protocol below in our hands.

The 10X V2 library structure is quite different from V1 (see here for details), so the primers need to change.

Reaction 1

Annealing temp: 65 degrees C, Kappa HiFi, 13ng+ of full length cDNA from cDNA amp as input

The reverse primer is no longer a P7 primer for V2, it is a partial R1 primer in the first reaction:

ACACTCTTTCCCTACACGACG
(WARNING: We designed this primer before seeing the full 10X library structure, so it only has 10bp of overlap with the cDNA amp products, but appears to work fine in our hands for the conditions provided here)
(EDIT April 13, 2018: we previously recommended CTACACGACGCTCTTCCGATCT, which is the sequence used by 10X in cDNA amplification. We have since found that this primer does not provide good amplification reliably in this enrichment PCR, so have reverted to the primer above with 10bp overlap.)

The forward primer for this PCR is:

TTTCCCATGATTCCTTCATATTTGC

which primes to an outer part of the U6 promoter.

Reaction 2

Annealing temp: 65 degrees C, Kappa HiFi, 1:25 dilution of reaction 1 as input

The remainder of R1 and P5 (separated by hyphen) is added in the second PCR (although could also do this at any point):

AATGATACGGCGACCACCGA-GATCTACACTCTTTCCCTACACGACGCTC

The forward primer is:

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-cTTGTGGAAAGGACGAAACAC

which primes on the U6 promoter adjacent to the guide sequence and adds the standard Nextera R2 primer.

Reaction 3

Annealing temp: 72 degrees C, Kappa HiFi, 1:25 dilution of reaction 2 as input

Same reverse primer from reaction 2 (see above):

AATGATACGGCGACCACCGA-GATCTACACTCTTTCCCTACACGACGCTC

We then index with nextera P7 index primers of the form:

CAAGCAGAAGACGGCATACGAGAT[8bp Index]GTCTCGTGGGCTCGG

Example Reaction

Here is an example of the products from each of the above 10X V2 enrichment PCR reactions run on a PAGE gel next to a unbiased 10X library as a reference (note there are two roughly 500bp bands for this ladder on PAGE gels): enrichment pcr

While there may be some other bands visible depending on exposure, we typically observe that approximately 99.9% of reads don't map to the reference used by cellranger (endogenous), and the majority of remaining fragments have what appear to be correct sequences with most remaining reads largely appearing to have errors due to things like sequencing errors, synthesis errors, PCR errors, etc. We have also seen a couple cells that have empty vectors with no guide (extremely infrequent).

While we have not tested them, protocols that reduce the number of steps using different primers or amplification directly from the final 10X libraries rather than unfragmented cDNA may both be feasible with some adjustments to primer sequences.

Other protocols

In principle, this protocol could be adapted to a number of different scRNA-seq methods. If it is not obvious how one might do this in your case, please let us know.

Useful Scripts

There are a couple scripts from this repository that we use for this type of experiment. Documentation for each script can be viewed with --help, but the important features are documented here. all but the last of these tools is fairly dependent on the output of the 10X genomics cellranger pipeline, so compatibility with other platforms will require tweaks.

Note that these scripts do not depend on any of the other files in this repository.

Script dependencies

There are some dependencies for each of these scripts.

We have run the python code under python 2.7.3+ and 3 (3.5+ is what we use), they should both be compatible. We have run the R code under R 3.3.0 but earlier versions may be compatible.

For python tools we report versions of the tools that we have used, but other versions may be compatible. For R tools we report required packages. Versions we have used are in sessionInfo in the larger R dependencies section; although other versions will be fine in many cases. We note the required packages for just these tools here.

The first tool, get_barcodes.py, requires:

  • pysam (pysam==0.10.0)
  • (optional) progressbar2 (progressbar2==3.34.3)
  • (optional) scikit-bio (scikit-bio==0.5.1): only compatible with python3, see advantages in documentation below.

The second tool, preprocess_cfg.R, requires:

  • dplyr
  • Matrix
  • monocle
  • stringr
  • argparse
  • ggplot2
  • gridExtra
  • scales
  • viridis
  • data.table
  • readr

The final tool, moi_capture_rate_generative_model.py, requires:

  • scipy (scipy==0.19.0)
  • numpy (numpy==1.13.3)

get_barcodes.py

We generally do PCR enrichment of the guide carrying Pol II transcripts and index them separately from the main unbiased 10X sequencing libraries. We then run these enrichment libraries as samples through cellranger (with the DNA sequence of the index specified instead of a SI-* ID) and then use the position sorted BAM files provided in the cellranger outputs as a starting point for obtaining the guide sequences observed in each cell.

We find this useful because cellranger corrects the cell barcode and UMI entries and puts them in tags within the BAM file. cellranger can also be run with secondary analysis turned off in its most recent versions via the --no-secondary option to cut down on time.

In order to run the script you will need a whitelist of guides (or barcodes) that were used in your library. For example, I might make a file whitelist.txt that contains the following:

GGATCTGTATCAAGCCGTTC
GATTTATTAGAGCGTCTTAA
AAAATGTCCCTCCGTTCTTA
GAAGTACTTAAACAACTACA

You then need to specify the sequence that will appear directly in front of the guide sequence/barcode in the 10X cDNA read. For example, in our CROP-seq experiments we happen to use: GTGGAAAGGACGAAACACCG

You may then run the script like so:

python get_barcodes.py --input_bams my_barcode_enrichment_cellranger_dir/outs/possorted_genome_bam.bam -o ko_barcodes.txt --whitelist whitelist.txt --search_seq GTGGAAAGGACGAAACACCG

The BAM file used as input may also be a space-separated list of BAM files if needed.

This will output a file that looks like this (TSV format):

cell               barcode                 read_count   umi_count
ATGACGTGCGACAT-1   GTCCGACCCTGGATGCCAAT    1037         27

Where each row is an observed barcode in a given cell and the associated read and UMI counts. There may also be a number of low count entries, and this is pretty typical and they are readily filtered in downstream analysis. Counts of zero in this file are the result of chimera removal described below.

By default, this script only examines unmapped reads, as it assumes that you have not modified your cellranger reference to include guide-harboring transcripts. This is done to help speed up the script given that we don't modify our cellranger reference. If you have included the additional transcripts in your reference such that the guide-harboring reads are largely mapped, you may use the --all_reads flag, which will force all reads to be examined.

By default, we use an unsupervised method for detecting chimeras from PCR via UMIs as described in Dixit et al.. This is a very simple method where, within each cell, we tabulate the number of times we observe each UMI and then tabulate the number of times we observe each UMI supporting each potential genotype. For each UMI/genotype combination if the ratio of the number of UMI observations in support of that genotype to all instances of that UMI in the cell less than 0.20, the reads are deemed to be chimeras (spurious molecules where the UMIs now appear on a different molecule than the original) and removed. This tends to clean out some of the spurious barcodes that we observe in cells. You may set to 0 to turn off or raise to be more stringent with the --chimeric_threshold argument.

We attempt to correct barcodes within a reasonable edit distance (which you may also set explicitly with --force_correction <int>). By default, we will allow min edit distance / 2 mismatches (rounded down) to be stringent. In either the default or user specified case we will correct to at most 3 mismatches and indels are not currently supported. Mismatches that could map to two different sequences are left uncorrected to avoid conflicts. If a barcode is observed that was not correctable to your whitelist it will be prefixed with unprocessed_. This may result from sequences missing from your whitelist or reads with high rates of sequencing error, for example.

Note that if you are running this script without scikit-bio installed (only available for python3), you will have to use the --no_swalign option. If you do have skbio, running with the default will allow the program to search for imperfect matches for the --search-seq thus rescuing as many reads as possible. It tries to allow for roughly 2 mismatches or an indel in the search sequence. Note that this only has marginal benefit when you have plenty of reads and the package is somewhat tricky to install (at least it was on my end).

Finally, a progress bar will be displayed when running this script if you have the progressbar2 package installed.

preprocess_cfg.R

After running get_barcodes.py, we usually take the barcode assignments above and pair them with the scRNA-seq data, outputting the files as a CellDataSet object in RDS format for use with monocle.

To do this you just have to make a metadata sheet (TSV format) for all the samples you want to combine, I'll call it sample_metadata.txt:

sample_directory              ko_barcode_file   condition    treatment
my_scrnaseq_cellranger_dir    ko_barcodes.txt   mycondition  mock

Only the first two columns are required, sample_directory or the top-level directory of your 10X scRNA-seq run (not the barcode enrichment one, this is your actual sample), and ko_barcode_file, which is the output file of the get_barcodes.py script. All other columns are optional and you can have any names you want. These fields will be propagated to metadata in output files if you choose to add them. Multiple samples can be included by including multiple rows.

You also have to provide the following TSV file, I'll call it gene_barcode_associations.txt:

APC            GAAGTACTTAAACAACTACA
APC            TGATCTTGACAAAGAAGAAA
APC            AGAGTGCAGTCCTGTTCCTA
ARID1A         GCGGTACCCGATGACCATGC
ARID1A         ATGGTCATCGGGTACCGCTG
ARID1A         CCCCTCAATGACCTCCAGTA

Where the first column (no headers) is a gene name (or whatever is relevant to your application) and the second column is the guide (or barcode) sequence. This second field should match the whitelist you provided to get_barcodes.py.

Finally, you may then run the following:

Rscript preprocess_cfg.R sample_metadata.txt output_cds.rds output_metadata.txt --guide_metadata gene_barcode_associations.txt --barcode_enrichment_qc_plot qc_plot.png

Note that the barcode_enrichment_qc_plot (described below) is optional but we think it is useful to examine for each experiment.

There are a few other options that you may want to change depending on your needs:

  • --genome: hg19 by default, but this must match the name of the genome used in your cellranger run
  • --ko_assignment_reads_threshold: 10 by default; the number of reads (or umis if --umis set) required for a barcode to be considered
  • --ko_assignment_proportion_threshold: 0.075 by default; the fraction of all reads (or umis if --umis set) from barcoded transcripts in each cell that a given barcode must exceed to be considered a real barcode
  • --aggregated: if you happen to use cellranger aggregate and you are pointing to aggregated output, you must set this flag
  • --umis: use UMI counts for thresholds and qc plot instead of read counts
  • --genotype_indicator_columns: this will add column for every individual target (combined across guides/barcodes) that has TRUE for cells that have this genotype present.
  • --size_factor_filter: we sometimes find it useful to remove clusters of cells with low average size factors and this turns that feature on (takes much longer because it will perform dimensionality reduction and clustering)
  • --log2_size_factor_threshold (default -0.85): when using --size_factor_filter, this is the threshold imposed in the log2(average size factor) for clusters.

Different ko_assignment_* thresholds can be chosen to be more or less strict about which barcodes should be included. For the time being, we typically just choose thresholds that seem reasonable; there is no automated strategy that we have developed thus far.

We have also explored using UMIs rather than reads for the latter two arguments and find that in some cases it improves results. If you want to use UMIs, you may specify the --umis option and the above thresholds will be with respect to UMI counts rather than read counts. The QC plot in this case would also use UMIs when using this option.

The main output files from this script are (as named in toy example above):

  • output_cds.rds: the monocle CellDataSet object in RDS format. Can be read into R with readRDS function. pData table of this CDS object is equivalent to the metadata table below.
  • output_metadata.txt: a TSV formatted metadata table of cells and their assigned barcodes and metadata fields. Note that the gene column will contain the assigned gene (or genes) based on your gene_barcode_association.txt file. There are also a set of indicator columns with TRUE when a barcode to a given gene is observed in a given cell, guide_count column or the number of guides observed in the cell (passing above thresholds), columns that specify the guide/barcode sequences observed, etc. Most of them should be fairly self explanatory.
  • qc_plot.png (optional) this is a plot that we typically make to perform a quick check of our barcode enrichment libraries and the thresholds we have chosen. An example is provided below (see the supplement of our paper for details and more examples).

Example QC plot: QC_PLOT

In a typical experiment, where one would have used a low MOI lentiviral transduction, one would expect that most of the points representing legitimate assignments in this plot (cell/observed barcode pairs) to fall towards the upper right -- they have a good number of reads and make up the vast majority of the barcodes observed in that cell.

There will be some portion of cells (in blue here) that have multiple barcodes assigned to them, which could be the result of doublets from scRNA-seq, or cells that were infected with more than one unique guide. In most of the analyses in our paper, we only use cells with a single assignment, but cells with multiple guides are included in the outputs of this script.

This plot also shows cells that are in the filtered set from 10X (so have high enough UMI counts to be considered a cell) but that do not have an assignment in orange. Cells that do not fall in the filtered set from 10X appear grey in these plots.

The thresholds set at the command line are reflected by the red lines spanning the plot horizontally and vertically. We often use this plot as a guide for setting reasonable thresholds to exclude points at the periphery that appear to be noise.

moi_capture_rate_generative_model.py

We also sometimes find it useful to use the approach outlined in Dixit et al. to estimate the most likely multiplicity of infection (MOI) and capture rate (rate at which you can ID the barcoded transcripts in cells given incomplete detection) from guide/barcode assignments. While we have had some success with this method, we have observed that it can also produce results that don't make sense under certain conditions, particularly when one has drawn inappropriate thresholds when using preprocess_cfg.R.

Note that this script is based heavily on code provided by Atray Dixit here and this is simply a convenient implementation of the ideas from Dixit et al..

The script is fairly simple, all you have to do is provide it with the metadata table output by preprocess_cfg.R (output_metadata.txt in the toy example above):

python moi_capture_rate_generative_model.py output_metadata.txt moi_capture_rate_likelihoods.txt

This script could also be used indepently of preprocess_cfg.R -- all you need is an input file with a column called guide_count which is the number of guides observed in each cell (must include zeros for cells with no guide observed!) and optionally another column that specifies the sample for each of the rows if you are running with multiple samples combined.

Note that there are a few other options that are worth considering:

  • --sample_column: if you have combined samples into one dataset, you'll want to specify the name of a column in the input table that distinguishes them from one another.
  • --capture_probability_min: 0 by default; the minimum capture rate of barcoded transcripts to consider
  • --capture_probability_max: 1 by default; the maximum capture rate of barcoded transcripts to consider
  • --capture_probability_step: 0.01 by default; step size when sweeping the capture rate parameter in estimates
  • --moi_min: 0.05 by default; the minimum MOI to consider.
  • --moi_max: 10 by default; the maximum MOI to consider (should somewhat higher than you think is likely, default typically works fine).
  • --moi_step: 0.1 by default; step size when sweeping MOI parameter in estimates

It will then output a file that looks something like this:

sample    capture_probability    moi       log_likelihood
NA        0.0                    0.05      -inf
NA        0.01                   0.05      -37796.863947
NA        0.02                   0.05      -32835.568872
NA        0.03                   0.05      -29935.8322619

If you have specified a sample column with --sample, the sample column above will indicate which sample the estimates apply to rather than having NA's.

To interpret results, you would look at some of the rows with highest log likelihood values. We recommend looking at a few of the best sets of parameters to see what the range of possible parameters could be. Again, we advise caution in using these estimates when the guide count distribution given your chosen thresholds deviates substantially from a poisson shifted left by incomplete capture (the model assumed by this method) or when the results seem otherwise implausible.

Data

Should you want to access our data or run the analyses presented in the paper directly, you may download the data in several ways.

GEO

We have deposited BAM files, the CellDataSet RDS files described below, as well as matrix-market formatted matrices with metadata on GEO along with documentation of the files if you prefer to download from there for your own purposes: GSE108699

Primary Data

We don't expect that many people will download the primary data, as it includes all BAM files and other data types that are very large. Most of the useful outputs for analyzing the data can be obtained as described in the Result Files section below.

This folder contains things like:

  • Outputs from cellranger pipeline (including BAM files)
  • Tables of guides we used in our study and their gene associations (also included in data.tiny folder in repo)
  • Data downloaded from Adamson et al. study as mentioned in our paper
  • Sample metadata sheets for each of the experiments in our study (also included in data.tiny folder in repo)
  • Sequencing data from our FACS swap rate experiments
  • GMT files used in gene set enrichment analyses (also included in data.tiny folder in repo)

This download is quite large at 166GB.

As mentioned above, we have also included a subset of these files separate from the full download in the data.tiny folder of this repo in case it is useful.

You would download via:

wget http://krishna.gs.washington.edu/content/members/ajh24/single_cell_ko_data_release/data.tar.gz
tar -xzvf data.tar.gz

Result Files

We expect that most people would be more interested in downloading just the processed results.

This folder contains results of the analyses; things like:

  • Monocle CDS objects containing expression matrices and metadata in RDS format for each scRNA-seq dataset
  • pdata (or cell metadata) tables for all experiments (includes KO assignments, etc.)
  • Results from DEG testing on screen data and on swap rate simulations of data
  • Capture rate / MOI parameter sweeps with log likelihoods
  • Intermediate data files for our tests for enrichment of genotypes in TSNE clusters

This is a much smaller download at 2.8GB and is probably of greater utility to the vast majority of people than the Primary Data.

You would download via:

wget http://krishna.gs.washington.edu/content/members/ajh24/single_cell_ko_data_release/temp_data.tar.gz
tar -xzvf temp_data.tar.gz

The following files may be of particular interest. All RDS files are CellDataSet objects compatible with monocle that contain all expression data and associated cell and gene metadata. These can be read into R using the readRDS function. With some basic familiarity with bioconductor/monocle one could also save these to matrix-market formatted files if desired.

  • aggregated_cds.rds: CDS from our CROP-seq screen of tumor suppressors
  • aggregated_cds_pdata.txt: metadata table for the above CDS as in TSV format
  • aggregated_cds.no_enrichment.rds: Same as aggregated_cds.rds but if the assignments were instead made without PCR enrichment libraries.
  • cropseq.sample_metadata.no_enrichment.txt: metadata table for the above CDS as in TSV format
  • aggregated_cds.initial_screens.rds: CDS from our initial pooled and arrayed screens aggregated using cellranger aggregate
  • aggregated_cds_pdata.initial_screens.txt: metadata table for the above CDS as in TSV format

Figures and tables

Figure panels and tables that went into the paper are already included in the repository:

  • figures
  • supplemental_figures
  • tables
  • reviewer_figures

Running Analyses from the Paper

We have also included all the scripts we used to perform the analyses in the paper in case it is useful.

This software is not supported; it is mostly intended to document how we did the analyses and put the scripts out in the open in case the ideas or implementations are useful to anyone.

Dependencies

The code is written in python and R, so both languages will need to be available. We have run this code under python 2.7.3+ and 3 (3.5+ is what we use), they should both be compatible. R 3.3.1 is the oldest version we have tested on.

Python

The following python packages are required (our package versions are noted but code may be compatible with other versions):

  • scipy (scipy==0.19.0)
  • pysam (pysam==0.10.0)
  • numpy (numpy==1.13.3)
  • (optional) progressbar2 (progressbar2==3.34.3)
  • (optional) scikit-bio (scikit-bio==0.5.1): only compatible with python3, can optionally be used when extracting gRNA sequences from reads
  • (optional) easygrid: this is a simple job management tool I made around the time of this project and is required for running runall.py, but not for anything else. Github. Note only works with SGE currently.

R

This is a list of packages loaded in the all the scripts provided:

  • argparse
  • colorRamps
  • dplyr
  • ggplot2
  • ggrepel
  • glmnet
  • grid
  • gridExtra
  • Matrix
  • matrixStats
  • monocle
  • parallel
  • piano
  • plyr
  • RColorBrewer
  • reshape2
  • scales
  • stringr
  • tidyr
  • viridis

Here is my sessonInfo after loading the packages above:

> sessionInfo()
R version 3.3.0 (2016-05-03)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: CentOS release 6.9 (Final)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C
 [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8
 [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C
 [9] LC_ADDRESS=C               LC_TELEPHONE=C
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C

attached base packages:
 [1] splines   stats4    parallel  grid      stats     graphics  grDevices
 [8] utils     datasets  methods   base

other attached packages:
 [1] viridis_0.4.0       viridisLite_0.2.0   tidyr_0.6.3
 [4] stringr_1.2.0       scales_0.5.0        reshape2_1.4.2
 [7] RColorBrewer_1.1-2  plyr_1.8.4          piano_1.12.1
[10] pheatmap_1.0.8      monocle_2.5.7       DDRTree_0.1.5
[13] irlba_2.2.1         VGAM_1.0-4          Biobase_2.32.0
[16] BiocGenerics_0.18.0 matrixStats_0.51.0  gridExtra_2.2.1
[19] glmnet_2.0-5        foreach_1.4.3       Matrix_1.2-6
[22] ggrepel_0.6.5       ggplot2_2.2.1       dplyr_0.7.3
[25] colorRamps_2.3      argparse_1.0.1      proto_0.3-10

loaded via a namespace (and not attached):
 [1] Rcpp_0.12.12           lattice_0.20-33        relations_0.6-6
 [4] gtools_3.5.0           assertthat_0.2.0       slam_0.1-34
 [7] R6_2.2.2               qlcMatrix_0.9.5        gplots_3.0.1
[10] rlang_0.1.2            lazyeval_0.2.0         gdata_2.18.0
[13] combinat_0.0-8         sets_1.0-16            Rtsne_0.13
[16] igraph_1.1.2           munsell_0.4.3          pkgconfig_2.0.1
[19] marray_1.50.0          findpython_1.0.1       tibble_1.3.4
[22] RANN_2.5               codetools_0.2-14       bitops_1.0-6
[25] densityClust_0.3       gtable_0.2.0           magrittr_1.5
[28] KernSmooth_2.23-15     stringi_1.1.5          bindrcpp_0.2
[31] getopt_1.20.0          limma_3.28.21          fastICA_1.2-1
[34] rjson_0.2.15           iterators_1.0.8        tools_3.3.0
[37] glue_1.1.1             HSMMSingleCell_0.106.2 colorspace_1.2-7
[40] cluster_2.0.4          caTools_1.17.1         bindr_0.1

While results should be similar for current versions of the following R packages, these are the exact commit hashes we used for the aanalysis in the paper, just for the record:

  • Monocle: commit 36cc7559db97108f5551534bef259832643d6e58
  • DensityClust: commit edfae798225b23cdeedc41367591e37648797943
  • DDRTree: commit 843607a5822276010cf4d47597213e607f7477a2

Compute Environment

We use SGE at UW Genome Sciences and the main driver script here, runall.py, uses a package I made called easygrid that manages job execution. It only supports SGE currently.

None of the individual scripts require easygrid or SGE but some of the analyses, particularly DEG testing in our CROP-seq data and in data where swap rates must be simulated and tested for DEGs many times, will become much less feasible to run if you are not using a cluster to parallelize them.

Data Downloads

You will have to have downloaded the Primary Data if trying to run everything or just the Result Files if you just want to try out some of the downstream analyses.

These must go in the main directory of the repo and must be called data and temp_data respectively to be compatible with the analysis scripts.

Running all analyses

If you have installed easygrid as mentioned above and want to run all analyses, you may use python runall.py to do so. Note that you must have SGE and again this is not supported if there happen to be technical issues that are non-trivial.

If you do not have SGE or easygrid, then you may use this script as a way of seeing how the analyses were performed and what commands are being issued.

We hope that even if you don't run all the analyses that you still find some of the scripts in this repository useful in thinking about your own analyses or in understanding how we arrived at results in the paper.

Many of the scripts (although not scripts that simply generate figures, etc.) have --help enabled to document arguments.

Citation

As mentioned above, if you use reagents from our paper, such as the CROP-seq vector optimized for use with CRISPRi, or software tools provided here, please cite:

Andrew J. Hill*, José L. McFaline-Figueroa*, Lea M. Starita, Molly J. Gasperini, Kenneth A. Matreyek, Jonathan Packer, Dana Jackson, Jay Shendure^, and Cole Trapnell^. 2018. “On the Design of CRISPR-Based Single-Cell Molecular Screens.” Nature Methods, February. https://doi.org/10.1038/nmeth.4604.

If you use CROP-seq and/or reagents from the Bock lab, please cite:

Paul Datlinger, André F Rendeiro*, Christian Schmidl*, Thomas Krausgruber, Peter Traxler, Johanna Klughammer, Linda C Schuster, Amelie Kuchler, Donat Alpar, Christoph Bock (2016). Pooled CRISPR screening with single-cell transcriptome readout. Nature Methods. DOI: 10.1038/nmeth.4177.