I-RNAsol

RNA solvent accessibility prediction using multi-view context-aware deep neural network

Pre-requisite:

• Linux system
• python3.7
• pytorch pytorch version 1.3.1
• Infernal infernal-1.1.3
• RNAfold ViennaRNA-2.4.18
• LinearPartition LinearPartition
• nt nt

Installation:

*Install and configure the softwares of python3.7, Pytorch, Infernal, RNAfold, LinearPartition, and nt in your Linux system. Please make sure that python3 includes the modules of 'os', 'math', 'numpy', 'configparser', 'numba', 'random', 'subprocess', 'sys', and 'shutil'. If any one modules does not exist, please using 'pip install xxx' command install the python revelant module. Here, "xxx" is one module name.

*Download this repository at https://github.com/XueQiangFan/I-RNAsol (80.1MB). Then, uncompress it and run the following command lines on Linux System.

  $ jar xvf I-RNAsol-main.zip
  $ chmod -R 777 ./I-RNAsol-main.zip
  $ cd ./I-RNAsol-main
  $ java -jar ./Util/FileUnion.jar ./save_model/ ./save_model.zip
  $ rm -rf ./save_model
  $ unzip save_model.zip 
  $ cd ../

Here, you will see one configuration files.
*Configure the following tools or databases in I-RNAsol.config
The file of "I-RNAsol.config" should be set as follows:

• Infernal
• LinearPartition
• RNAfold
• nt

  For example:  
  [Infernal]
  Infernal = /iobio/fxq/software/infernal-1.1.3-linux-intel-gcc/binaries
  cmsearch_DB = /iobio/fxq/library/database/nt.fa/nt
  [RNAfold]
  RNAfold_EXE = /iobio/fxq/software/ViennaRNA-2.4.17/bin/RNAfold
  [LinearPartition]
  LinearPartition_EXE = /iobio/fxq/software/LinearPartition-master/linearpartition

Note: Make sure there is enough space on the system as NCBI's nt database is of size around 333 GB after extraction and it can take couple of hours to download depending on the internet speed. In case of any issue, please rerfer to https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&DOC_TYPE=Download

Run I-RNAsol

run: python main.py -n RNA name -s RNA sequence -o result path

    For example:
    python main.py -n 1f1t_A -s GGACCCGACGGCGAGAGCCAGGAACGAAGGACC -o ./

The RNA solvent accessibility result

*The protein solvent accessibility result of each rsidue should be found in the outputted file, i.e., " protein name +.rsa". In each result file, where "NO" is the position of each residue in your RNA, where "AA" is the name of each residue in your RNA, where "RSA" is the predicted relative accessible surface area of each residue in your RNA, and where "ASA" is the predicted accessible surface area of each nucleotide in your RNA.

Update History:

First release 2026-04-20

References

[1] .