Skip to content

bsipos/rlsim

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

79 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

rlsim - a package for simulating RNA-seq library preparation with parameter estimation

rlsim architecture

What is the rlsim package?

The rlsim package is a collection of tools for simulating RNA-seq library construction, aiming to reproduce the most important factors which are known to introduce significant biases in the currently used protocols: hexamer priming, PCR amplification and size selection. It allows for a systematic exploration of the effects of the individual biasing factors and their interactions on downstream applications by simulating data under a variety of parameter sets.

The implicit simulation model implemented in the main tool (rlsim) is inspired by the actual library preparation protocols and it is more general than the models used by the bias correction methods hence it allows for a fair assessment of their performance.

Although the simulation model was kept as simple as possible in order to aid usability, it still has too many parameters to be inferred from data produced by standard RNA-seq experiments. However, simulating datasets with properties similar to specific datasets is often useful. To address this, the package provides a tool (effest) implementing simple approaches for estimating the parameters which can be recovered from standard RNA-seq data (GC-dependent amplification efficiencies, fragment size distribution, relative expression levels).

Catalogued on GSR

Citing the rlsim package

An associated manuscript is in preparation, meanwhile the package should be cited as:

  • Botond Sipos, Greg Slodkowicz, Tim Massingham, Nick Goldman (2013) Realistic simulations reveal extensive sample-specificity of RNA-seq biases arXiv:1308.3172

The analysis pipeline used to generate the results is available at github.com/bsipos/paper-rlsim.

rlsim was brought to you by the Goldman group from EMBL-EBI.

Key features

  • Simulation of priming biases loosely based on a nearest-neighbor thermodynamic model.

  • Exact simulation of PCR amplification on the level of individual fragments (consistent across expression levels, no approximations).

  • Fragment-specific amplification efficiencies determined by GC-content and length.

  • Possibility to simulate PCR and sampling pseudo-replicates.

  • Simulation of size selection and polyadenylation with flexible target distributions.

  • Estimation of GC-dependent amplification efficiencies from real data, relying on assumptions about locality of biases and the mean efficiency of the fragment pool.

  • Estimation of relative expression levels.

  • Estimation of empirical fragment size distribution, model selection between normal vs. skew normal distributions.

  • Able to simulate experiments on the human transcriptome over a wide range of expression levels on a desktop machine.

Basic examples

The following basic examples can be run from the src/ directory in the package source tree:

  • Re-sample expression levels from a mixture of gamma distributions with two components with mean 5,000 and 10,000:
        $ ../tools/sel -d "0.5:g:(5000, 0.1) + 0.5:g:(10000, 100)" \
        test/basic/test_transcripts.fas > my_transcripts.fas
The output my\_transcripts.fas is a Fasta file annotated with the
expression levels:
        >ENST00000371588$9430
        GCTTCCGGCATCTGGCTCAGTTCCGCCATGGCCTCCTTGGAAGTCAGTCGTAGTCCTCGCAGGTCTCGGCGGGAGCTG ...
        ...
  • Simulate 10,000 fragments with default parameters, plot rlsim report:
        $ ./rlsim -n 10000 my_transcripts.fas > frags.fas
        $ ../tools/plot_rlsim_report
The output file frags.fas contains the simulated fragments:
        >Frag_0 ENST00000374005 (Strand - Offset 1883 -- 2298)
        AGAGAATAGAGGGTAGAAGGGAAATTCTTGGCACCTGGACTAGAGTGAGATAAAAGGAGAGTAGGAAAGCAGTGA ...
        ...
  • Simulate paired-end sequencing using simNGS and the runfile shipped with the package source:
        $ cat frags.fas | simNGS -p paired -o fastq -O reads test/cov/s_4_0066.runfile
The files `reads_end1.fq` and `reads_end1.fq` contain the simulated
paired-end reads:
        @Frag_24929 refB (Strand - Offset 11583 -- 12067) 151M
        GCCCCGAGTAGTTCTGGGCGGGGCCCCCGCGGCCAGCGCCGCCCACTATATATTATTTATTCTAACTATT ...
        +
        GGGEFG(EGFGGDGBFEGGG;FD7GEGGDGGA=GGGDG7FFGGGGGFGCAGGGGGFF?GGGFG@GGAGGG ...
        ...
  • Simulate 500,000 fragments, skew normal fragment size distribution with a spike, after_prim_double fragmentation method, 15 PCR cycles with the specified efficiency parameters, using 4 cores, verbose mode:
        $ ./rlsim -n 50000 -d "0.9:sn:(600,50,4,300,2000) + 0.1:n:(700,1,600,2000)" \
        -f after_prim_double -c 15 -eg "(1.0,0.5,0.8)" -el "(0.1,0.7,1.0)" \
        -t 4 -v my_transcripts.fas > frags.fas
        $ ../tools/plot_rlsim_report
  • Estimate parameters from SAM file sorted by read name using (verbose mode):
        $ ../tools/effest -v -f ../tools/test/ref.fas ../tools/test/aln1.sam 
  • Estimate parameters from SAM file sorted by read name using – assume 15 PCR cycles and a pool efficiency of 0.9:
        $ ../tools/effest -v -c 15 -m 0.9 -f ../tools/test/ref.fas ../tools/test/aln1.sam 
  • Simulate 20,000 fragments using the raw parameters estimated by effest, set minimum GC-dependent efficiency to 0.5 (verbose mode):
        $ ./rlsim -v -n 20000 -j raw_params.json -jm 0.5 my_transcripts.fas > frags.fas
        $ ../tools/plot_rlsim_report

Getting more help

Please consult the package documentation for more help on the tools and the technical background.

The BioStar Q&A forum (http://www.biostars.org) is an excellent place to get additional help. The author of the package will monitor the posts having the rlsim tag.

Dependencies

The package runs on 64-bit GNU/Linux operating systems. The rlsim tool is written in golang and shipped as a statically linked executable for the amd64 Linux platforms, hence it has no dependencies.

The rlsim tool can be built for other architectures supported by the compiler, however only the amd64 architecture is supported and the 32-bit binaries might not work properly.

The parameter estimation tool (effest) and the additional tools are written in Python 2.x and depend on a couple of packages:

These packages (with the exception of the modified HTSeq) are readily installable from the Python Package Index using the pip tool by issuing the following command:

    pip install numpy matplotlib scipy biopython

The additional tool tools depend on samtools samtools. Simulating Illumina sequencing of the fragments can be done by using the simNGS package (recommended) or any other sequencing simulator.

Installing the latest release

The release tarballs can be obtained from the releases directory:

    wget https://github.com/bsipos/rlsim/blob/master/releases/rlsim-latest_amd64.tar.gz?raw=true t.tgz -O rlsim-latest_amd64.tar.gz

The unpacked release directory contains the following files:

  • bin/ – directory containing the executables:

    • rlsim – the main tool simulating library construction

    • effest – tool for estimating selected parameters from real datasets

    • sel – tool for sampling expression levels

    • plot_rlsim_report– tool for plotting the rlsim report

    • pb_plot – tool for visualising sequence biases

    • cov_cmp – tool for comparing coverage trends across datasets

    • plot_cov – tool for plotting transcript read coverage colored by reference base

  • COPYING – GPL v3 licence

  • README.md – short instructions in markdown format

  • rlsim_manual.pdf – package manual

The executables under bin/ can be installed by copying them to a directory listed in the $PATH environmental variable.

Building from source

Build dependencies:

  • The package is built using make in a standard Linux environment.

  • Building the rlsim tool requires the Go compiler which can be installed as described on the projects website.

  • A standard LaTeX installation with pdflatex has to be present in order to produce the package documentation.

  • Regenerating the test datasets needs the bwa bwa and samtools commands to be installed.

The package source can be obtained by cloning the GitHub repository and built by issuing make in the top level directory:

    git clone https://github.com/bsipos/rlsim.git
    cd rlsim
    make

A tarball can be built by issuing:

   make release

Experimental builds with gccgo

rlsim can be compiled with the recent version (>=4.7.2) of the gccgo compiler:

  • Install the gc Go compiler suite on the projects website, as the build process uses the go tool.

  • Install gccgo as described here, or through your package manager.

  • Issue make gccbuild under `src/'.

Benchmarks indicate that the gccgo build is faster on average, however the difference in runtime is not substantial.

Please note that the experimental gccgo builds are not supported. Feel free to use them, but please do not submit bug reports if anything goes wrong.

Quick reference

rlsim

    Simulate RNA-seq library preparation with priming biases, PCR biases and size selection (version: 1.3).

    Usage:
            rlsim [arguments] [transcriptome fasta files (optional)]

    Optional arguments:
                    argument                    type    default  
            -n      requested fragments         int     
            -d      fragment size distribution  string  "1.0:sn:(189, 24, -1.09975, 76, 294)" 
            -f      fragmentation method        string  "after_prim_double"
            -b      strand bias                 float   0.5
            -c      PCR cycles                  int     11
            -p      priming bias parameter      float   5.0
            -k      primer length               int     6
            -a      poly(A) tail size dist.     string  [check source]
            -flg    fragment loss probability   float   0.0
            -m      expression level multiplier float   1.0
            -e      fixed PCR efficiency        float   0.0
            -eg     GC efficiency parameters 
                    as "(shape, min, max)":     raw from SRR521457
            -el     length efficiency parameters 
                    as "(shape, min, max)":
                        shape                   float   0.0
                        min                     float   1.0
                        max                     float   1.0
            -j      raw parameter file          string  
                    superseeds -d, -c, -eg
            -jm     minimum raw gc efficiency   float   0.0
            -r      report file                 string  "rlsim_report.json"
            -t      number of cores to use      int     4
            -g      keep fragments in memory    bool    false
            -si     initial random seed         int     from UTC time
            -sp     pcr random seed             int     auto
            -ss     sampling random seed        int     auto
            -gobdir fragment directory          string  "rlsim_gob_$PID"
            -v      toggle verbose mode         bool    false
            -h      print usage and exit        bool    false
            -V      print version and exit      bool    false
            -prof   write CPU profiling info    string  ""
            -gcfreq trigger garbage collection  int     100
                    after this many transcripts
            -randt  generate RNG test files     bool    false

    Examples:
            rlsim -n 2000000 transcripts.fa
            cat transcripts.fa | rlsim -n 2000000

    For more details consult the package manual at:
            https://github.com/bsipos/rlsim/tree/master/doc/rlsim_manual.pdf

effest

    usage: effest [-h] [-f ref_fasta] [-i iso_list] [-c nr_cycles] [-m mean_eff]
                  [-M max_eff] [-d dist_fam] [-g out_fasta] [-j out_json]
                  [-e expr_mul] [-a] [-t] [-w step_size] [-s out_count_file]
                  [-k in_count_file] [-p out_prior_file] [-o in_prior_file]
                  [-q min_qual] [-r report_file] [-l log_file] [-v]
                  [input file]

    Estimate GC-dependent fragment amplification efficiencies and fragment size
    distribution from paired-end RNA-seq data mapped to transcriptome (version
    1.1).

    positional arguments:
      input file         Aligned *paired end* reads in SAM format sorted by
                         *name*.

    optional arguments:
      -h, --help         show this help message and exit
      -f ref_fasta       Reference fasta.
      -i iso_list        List of single isoform transcripts.
      -c nr_cycles       Number of PCR cycles (11).
      -m mean_eff        Assumed pool efficiency (0.87).
      -M max_eff         Assumed maximum efficiency (None).
      -d dist_fam        Distribution to model fragment size distribution
                         (n|sn|*auto*).
      -g out_fasta       Output fasta.
      -j out_json        File to store estimated raw parameters (raw_params.json).
      -e expr_mul        Expression level multiplier (10000.0).
      -a                 Do not use GC efficiency correction on expression levels
                         (False).
      -t                 Trim off old expression values (True).
      -w step_size       Sliding window size / step size ratio (5).
      -s out_count_file  Pickle counts to the specified file (effest_counts.pk).
      -k in_count_file   Load counts from specifies file.
      -p out_prior_file  Pickle fragment prior to the specified file
                         (effest_pr.pk).
      -o in_prior_file   Load fragment prior from the specified pickle file.
      -q min_qual        Minimum mapping quality (0).
      -r report_file     Report PDF (effest_report.pdf).
      -l log_file        Log file.
      -v                 Toggle verbose mode (False).

plot_rlsim_report

    usage: plot_rlsim_report [-h] [input file]

    Plot rlsim report (version 1.0).

    positional arguments:
      input file  rlsim report file.

    optional arguments:
      -h, --help  show this help message and exit

sel

   usage: sel [-h] [-t] [-d dist_param] [-b nr_bins] [-r report_fil]
               [input fasta file]

    Sample expression levels from a mixture of gamma distributions (version 1.0).

    positional arguments:
      input fasta file  Transcripts and expression levels in Fasta format.

    optional arguments:
      -h, --help        show this help message and exit
      -t                Trim sequence names.
      -d dist_param     Expression level distribution.
      -b nr_bins        Number of bins in histogram.
      -r report_fil     Report PDF file.

pb_plot

    usage: pb_plot [-h] [-f ref_fasta] [-r report_file] [-w winsize] [-i tr_list]
                   [-q min_qual] [-p pickle_file] [-s]
                   [input file]

    Visualise sequence biases around fragment start/end (version 1.1).

    positional arguments:
      input file      Aligned *paired end* reads in SAM format.

    optional arguments:
      -h, --help      show this help message and exit
      -f ref_fasta    Reference sequences in fasta format.
      -r report_file  Name of PDF report file.
      -w winsize      Window size.
      -i tr_list      List of single isoform transcripts.
      -q min_qual     Minimum mapping quality.
      -p pickle_file  Results pickle file.
      -s              Assume single ended dataset.

cov_cmp

    usage: cov_cmp [-h] -f ref_fasta [-g] [-t nr_top] [-c min_cov] [-i iso_list]
                   [-l min_length] [-x] [-y] [-r report_file] [-q min_qual]
                   [-p pickle_file] [-v] [-s]
                   input file input file

    Compare relative coverage trends between the *expressed* transcripts of two
    datasets (version 1.1).

    positional arguments:
      input file      Two sets of aligned *paired end* reads in SAM format.

    optional arguments:
      -h, --help      show this help message and exit
      -f ref_fasta    Reference sequences in fasta format.
      -g              Do not color by AT/GC.
      -t nr_top       Plot at least this many top matches (30).
      -c min_cov      Minimum number of fragments per transcript (20).
      -i iso_list     List of single isoform genes.
      -l min_length   Minimum transcript length.
      -x              Sort by correlation coefficients.
      -y              Plot pairwise cumulative coverage.
      -r report_file  Name of PDF report file.
      -q min_qual     Minimum mapping quality (0).
      -p pickle_file  Results pickle file.
      -v              Toggle verbose mode.
      -s              Assume single ended dataset.

plot_cov

    usage: plot_cov [-h] -r ref_fasta -b bam [-o outfile]

    Plot read coverage colored by the reference base (AT - blue, GC - red). This
    tools requires samtools to be installed in path.

    optional arguments:
      -h, --help    show this help message and exit
      -r ref_fasta  Reference transcriptome.
      -b bam        Position sorted and indexed BAM file.
      -o outfile    Output PDF (plot_cov.pdf).

About

A package for simulating RNA-seq library preparation with parameter estimation

Resources

License

Stars

0 stars

Watchers

1 watching

Forks

Packages

 
 
 

Contributors

Languages

  • Go 90.8%
  • Makefile 7.0%
  • Perl 1.1%
  • Other 1.1%