Skip to content

Fix test syntax issues.#530

Closed
jmchilton wants to merge 1 commit into
galaxyproject:mainfrom
jmchilton:fix_test_syntax
Closed

Fix test syntax issues.#530
jmchilton wants to merge 1 commit into
galaxyproject:mainfrom
jmchilton:fix_test_syntax

Conversation

@jmchilton

Copy link
Copy Markdown
Member

I guess @mvdbeek already did this with an alternative way of automatically verifying the syntax with https://github.com/galaxyproject/iwc/pull/317/files. This is what it took to get some pydantic models I'm working on to pass - though I still am skipping a few assembly workflows that use a syntax for checking output parameter values that I need to figure out how to model.

@lldelisle

Copy link
Copy Markdown
Contributor

Thanks John very useful. I will change the workflow I am responsible of.

@lldelisle

Copy link
Copy Markdown
Contributor

He did it in #317 but unfortunately few have integrated the changes....

@lldelisle

Copy link
Copy Markdown
Contributor

If it is ok for you. We can split this PR into 2.
One with the fixes which makes the tests pass and one with what lefts.

@lldelisle

Copy link
Copy Markdown
Contributor

Is there a way to integrate this into planemo lint?

@jmchilton

Copy link
Copy Markdown
Member Author

It will make its way there - I'm going to open the PR to Galaxy's tool_util package today that is the first step.

@lldelisle

Copy link
Copy Markdown
Contributor

Thanks.

@lldelisle

Copy link
Copy Markdown
Contributor

I put here the output of the tests:

Test Summary

Test State Count
Total 20
Passed 13
Error 0
Failure 7
Skipped 0

@lldelisle

Copy link
Copy Markdown
Contributor

Here are the failed tests one by one:

  • ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

    Problems:

    • Output with path /tmp/tmp8i_jujgd/Hifiasm HiC hap1__19cc3e1e-d017-45cb-a96f-22ec0d45695a different than expected
      Expected 168+-0 lines in the output found 144
      
    • Output with path /tmp/tmpbefrhk1m/usable hap1 gfa__6a5f73f8-1d2d-426e-a55b-54b1b4ff8694 different than expected
      Expected 173+-0 lines in the output found 145
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: Pacbio Reads Collection:

        • step_state: scheduled
      • Step 2: HiC forward reads:

        • step_state: scheduled
      • Step 11: SAK input file:

        • step_state: scheduled
      • Step 12: Homozygous Read Coverage:

        • step_state: scheduled
      • Step 13: Genomescope Model Parameters:

        • step_state: scheduled
      • Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -f -s '/tmp/tmpz1b2i2gf/files/4/a/3/dataset_4a318594-0f19-4861-8cfa-baaf1f2ed397.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              adapter_options {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              filter_options {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
              library {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
              other_trimming_options {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
              output_selector ["report", "json_stats"]
              read_mod_options {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}
      • Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpz1b2i2gf/files/2/9/0/dataset_2905cf1b-ef21-403d-a808-c89ea896f424.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/8/outputs/dataset_44b95a8a-1797-4e1b-911f-0a9f339b7c73.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              case_sensitive "-i"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              color "NOCOLOR"
              dbkey "?"
              invert ""
              lines_after "0"
              lines_before "0"
              regex_type "-G"
              url_paste "Haploid"
      • Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpz1b2i2gf/job_working_directory/000/9/configs/tmpccsrvvv9' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpz1b2i2gf/files/2/b/8/dataset_2b8cea0a-4d35-4d8a-9917-0d27dad17fee.dat' '/tmp/tmpz1b2i2gf/job_working_directory/000/9/outputs/dataset_dbc301c9-d277-4ee6-b304-be7dc1ee5eee.dat'

            Exit Code:

            • 0

            Standard Output:

            • Computing 1 new columns with instructions ['c3*2;;']
              Computed new column values for 100.00% of 1 lines written.
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              avoid_scientific_notation false
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              error_handling {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
              ops {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}
      • Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmpz1b2i2gf/files/e/d/8/dataset_ed89ccd9-c5b7-4d75-a3b2-18b2e03dd681.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&  multiqc multiqc_WDir --filename 'report'

            Exit Code:

            • 0

            Standard Error:

            •   /// MultiQC 🔍 | v1.11
              
              |           multiqc | MultiQC Version v1.25 now available!
              |           multiqc | Search path : /tmp/tmpz1b2i2gf/job_working_directory/000/10/working/multiqc_WDir
              |          cutadapt | Found 1 reports
              |           multiqc | Compressing plot data
              |           multiqc | Report      : report.html
              |           multiqc | Data        : report_data
              |           multiqc | MultiQC complete
              

            Standard Output:

            • |         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 2/2  

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              comment ""
              dbkey "?"
              export false
              flat false
              results [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}]
              saveLog false
              title ""
      • Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpz1b2i2gf/files/4/4/b/dataset_44b95a8a-1797-4e1b-911f-0a9f339b7c73.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/11/outputs/dataset_fdc6c86c-7839-4094-bec0-6baf2a0447d5.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              replacements [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]
      • Step 19: Cut1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • perl '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpz1b2i2gf/files/d/b/c/dataset_dbc301c9-d277-4ee6-b304-be7dc1ee5eee.dat' 'c7' T '/tmp/tmpz1b2i2gf/job_working_directory/000/12/outputs/dataset_67e03ee4-db92-4904-b1de-2d50de6aa7cc.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              columnList "c7"
              dbkey "?"
              delimiter "T"
      • Step 20: Convert characters1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python /tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpz1b2i2gf/files/f/d/c/dataset_fdc6c86c-7839-4094-bec0-6baf2a0447d5.dat s /tmp/tmpz1b2i2gf/job_working_directory/000/13/outputs/dataset_f6ee4b35-6108-4a20-8d5b-b7c2ac8c0660.dat

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              condense true
              convert_from "s"
              dbkey "?"
              strip true
      • Step 3: HiC reverse reads:

        • step_state: scheduled
      • Step 21: Estimated homozygous read coverage:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "integer"
              remove_newlines true
      • Step 22: Cut1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • perl '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpz1b2i2gf/files/f/6/e/dataset_f6ee4b35-6108-4a20-8d5b-b7c2ac8c0660.dat' 'c3' T '/tmp/tmpz1b2i2gf/job_working_directory/000/15/outputs/dataset_760b9ced-d97e-4a23-a6e6-b5ccbd8126ad.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              columnList "c3"
              dbkey "?"
              delimiter "T"
      • Step 23: Homozygous read coverage for Hifiasm:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              style_cond {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}
      • Step 24: Estimated genome size:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "integer"
              remove_newlines true
      • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpz1b2i2gf/files/6/b/f/dataset_6bf79f47-592c-43b1-bd07-6c74d2e53075.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpz1b2i2gf/files/c/f/5/dataset_cf5d6fda-0e97-49b7-bc3e-81228d929d27.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpz1b2i2gf/files/0/0/3/dataset_00358080-8ee5-4718-908a-11f233f96db2.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "fastq.gz"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              advanced_options {"__current_case__": 0, "advanced_selector": "blank"}
              assembly_options {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}
              bins_out false
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              filter_bits "32"
              hic_partition {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null}
              log_out true
              mode {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}}
              ont_integration {"__current_case__": 0, "ont_integration_selector": "blank"}
              purge_options {"__current_case__": 0, "purge_selector": "blank"}
              scaffolding_options {"__current_case__": 0, "scaffold_selector": "blank"}
      • Step 26: Raw Unitig Image:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpz1b2i2gf/files/a/3/3/dataset_a332de0a-3544-4d0d-90b7-4c20a967e482.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              fontsize None
              height "2000"
              lengths false
              names false
              nodewidth "25.0"
              output_format "png"
              width None
      • Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/c/5/e/dataset_c5ebe280-2519-44ab-b336-5cc859155ef2.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpz1b2i2gf/job_working_directory/000/20/outputs/dataset_466c5877-835a-4272-8160-094f7cbce6e1.dat' --threads ${GALAXY_SLOTS:-8}

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/b/5/5/dataset_b55ad96f-1df3-44e8-9fef-de905c9d87fb.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpz1b2i2gf/job_working_directory/000/21/outputs/dataset_152b3611-84df-481e-a78e-db9920cceece.dat' --threads ${GALAXY_SLOTS:-8}

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/c/5/e/dataset_c5ebe280-2519-44ab-b336-5cc859155ef2.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpz1b2i2gf/job_working_directory/000/22/outputs/dataset_e5c87134-7e60-46c5-a37f-696179b78c84.dat' --threads ${GALAXY_SLOTS:-8}

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/c/5/e/dataset_c5ebe280-2519-44ab-b336-5cc859155ef2.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

            Exit Code:

            • 0

            Standard Output:

            • +++Assembly summary+++: 
              # scaffolds: 35
              Total scaffold length: 1008829
              Average scaffold length: 28823.69
              Scaffold N50: 24719
              Scaffold auN: 47664.45
              Scaffold L50: 10
              Largest scaffold: 132637
              Smallest scaffold: 11730
              # contigs: 35
              Total contig length: 1008829
              Average contig length: 28823.69
              Contig N50: 24719
              Contig auN: 47664.45
              Contig L50: 10
              Largest contig: 132637
              Smallest contig: 11730
              # gaps in scaffolds: 0
              Total gap length in scaffolds: 0
              Average gap length in scaffolds: 0.00
              Gap N50 in scaffolds: 0
              Gap auN in scaffolds: 0.00
              Gap L50 in scaffolds: 0
              Largest gap in scaffolds: 0
              Smallest gap in scaffolds: 0
              Base composition (A:C:G:T): 303859:199058:199884:306028
              GC content %: 39.55
              # soft-masked bases: 0
              # segments: 35
              Total segment length: 1008829
              Average segment length: 28823.69
              # gaps: 0
              # paths: 35
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 4: Genomescope Summary:

        • step_state: scheduled
      • Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/b/5/5/dataset_b55ad96f-1df3-44e8-9fef-de905c9d87fb.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpz1b2i2gf/job_working_directory/000/24/outputs/dataset_2c4dfce8-1151-4bae-b575-97b8955a06b8.dat' --threads ${GALAXY_SLOTS:-8}

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/b/5/5/dataset_b55ad96f-1df3-44e8-9fef-de905c9d87fb.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

            Exit Code:

            • 0

            Standard Output:

            • +++Assembly summary+++: 
              # scaffolds: 72
              Total scaffold length: 1778748
              Average scaffold length: 24704.83
              Scaffold N50: 22121
              Scaffold auN: 35945.06
              Scaffold L50: 25
              Largest scaffold: 132637
              Smallest scaffold: 11410
              # contigs: 72
              Total contig length: 1778748
              Average contig length: 24704.83
              Contig N50: 22121
              Contig auN: 35945.06
              Contig L50: 25
              Largest contig: 132637
              Smallest contig: 11410
              # gaps in scaffolds: 0
              Total gap length in scaffolds: 0
              Average gap length in scaffolds: 0.00
              Gap N50 in scaffolds: 0
              Gap auN in scaffolds: 0.00
              Gap L50 in scaffolds: 0
              Largest gap in scaffolds: 0
              Smallest gap in scaffolds: 0
              Base composition (A:C:G:T): 543138:342989:347557:545064
              GC content %: 38.82
              # soft-masked bases: 0
              # segments: 72
              Total segment length: 1778748
              Average segment length: 24704.83
              # gaps: 0
              # paths: 72
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/c/5/e/dataset_c5ebe280-2519-44ab-b336-5cc859155ef2.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

            Exit Code:

            • 0

            Standard Output:

            • +++Assembly summary+++: 
              # scaffolds: 35
              Total scaffold length: 1008829
              Average scaffold length: 28823.69
              Scaffold N50: 24719
              Scaffold auN: 47664.45
              Scaffold L50: 10
              Largest scaffold: 132637
              Smallest scaffold: 11730
              # contigs: 35
              Total contig length: 1008829
              Average contig length: 28823.69
              Contig N50: 24719
              Contig auN: 47664.45
              Contig L50: 10
              Largest contig: 132637
              Smallest contig: 11730
              # gaps in scaffolds: 0
              Total gap length in scaffolds: 0
              Average gap length in scaffolds: 0.00
              Gap N50 in scaffolds: 0
              Gap auN in scaffolds: 0.00
              Gap L50 in scaffolds: 0
              Largest gap in scaffolds: 0
              Smallest gap in scaffolds: 0
              Base composition (A:C:G:T): 303859:199058:199884:306028
              GC content %: 39.55
              # soft-masked bases: 0
              # segments: 35
              Total segment length: 1008829
              Average segment length: 28823.69
              # gaps: 0
              # paths: 35
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • gfastats '/tmp/tmpz1b2i2gf/files/b/5/5/dataset_b55ad96f-1df3-44e8-9fef-de905c9d87fb.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

            Exit Code:

            • 0

            Standard Output:

            • +++Assembly summary+++: 
              # scaffolds: 72
              Total scaffold length: 1778748
              Average scaffold length: 24704.83
              Scaffold N50: 22121
              Scaffold auN: 35945.06
              Scaffold L50: 25
              Largest scaffold: 132637
              Smallest scaffold: 11410
              # contigs: 72
              Total contig length: 1778748
              Average contig length: 24704.83
              Contig N50: 22121
              Contig auN: 35945.06
              Contig L50: 25
              Largest contig: 132637
              Smallest contig: 11410
              # gaps in scaffolds: 0
              Total gap length in scaffolds: 0
              Average gap length in scaffolds: 0.00
              Gap N50 in scaffolds: 0
              Gap auN in scaffolds: 0.00
              Gap L50 in scaffolds: 0
              Largest gap in scaffolds: 0
              Smallest gap in scaffolds: 0
              Base composition (A:C:G:T): 543138:342989:347557:545064
              GC content %: 38.82
              # soft-masked bases: 0
              # segments: 72
              Total segment length: 1778748
              Average segment length: 24704.83
              # gaps: 0
              # paths: 72
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mode_condition {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
              target_condition {"__current_case__": 0, "target_option": "false"}
      • Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpz1b2i2gf/job_working_directory/000/28/configs/tmpry1n2nxy' '/tmp/tmpz1b2i2gf/files/4/6/6/dataset_466c5877-835a-4272-8160-094f7cbce6e1.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/28/outputs/dataset_18d9c8e6-9d48-4d4c-bc23-c65e6ef52c60.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              code "BEGIN{print \"Metric\\thap2\"}; {print}; "
              dbkey "?"
      • Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpz1b2i2gf/job_working_directory/000/29/configs/tmpja46r4nk' '/tmp/tmpz1b2i2gf/files/1/5/2/dataset_152b3611-84df-481e-a78e-db9920cceece.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/29/outputs/dataset_17d31647-1fd0-4c95-9d81-9a6d0e1e4c31.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              code "BEGIN{print \"Metric\\thap1\"}; {print}; "
              dbkey "?"
      • Step 37: Data Prep Hap2:

        • step_state: scheduled

        • Subworkflow Steps
          • Step 1: gfa_stats:

            • step_state: scheduled
          • Step 2: sort1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpz1b2i2gf/files/e/5/c/dataset_e5c87134-7e60-46c5-a37f-696179b78c84.dat' --output='/tmp/tmpz1b2i2gf/job_working_directory/000/30/outputs/dataset_9df69501-ee38-4a2e-9bb5-d723786848c2.dat'    --key=2,2nr   --header 0

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  column "2"
                  column_set []
                  dbkey "?"
                  header_lines "0"
                  order "DESC"
                  style "num"
          • Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpz1b2i2gf/job_working_directory/000/31/configs/tmp97tfid5p' '/tmp/tmpz1b2i2gf/files/9/d/f/dataset_9df69501-ee38-4a2e-9bb5-d723786848c2.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/31/outputs/dataset_c398bcea-852c-4336-a9fe-9fd4b807f109.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  code "{total += $2; $3 = total}1"
                  dbkey "?"
          • Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • datamash         absmax 3 < /tmp/tmpz1b2i2gf/files/c/3/9/dataset_c398bcea-852c-4336-a9fe-9fd4b807f109.dat > '/tmp/tmpz1b2i2gf/job_working_directory/000/32/outputs/dataset_6effa342-5540-4904-8e6f-d826fa7a15e8.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  grouping ""
                  header_in false
                  header_out false
                  ignore_case false
                  narm false
                  need_sort false
                  operations [{"__index__": 0, "op_column": "3", "op_name": "absmax"}]
                  print_full_line false
          • Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpz1b2i2gf/files/c/3/9/dataset_c398bcea-852c-4336-a9fe-9fd4b807f109.dat" "/tmp/tmpz1b2i2gf/job_working_directory/000/33/outputs/dataset_a9866497-009a-4154-92fc-4bd336dee8a6.dat" "1" "yes"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  exp "1"
                  iterate "yes"
          • Step 6: param_value_from_file:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  param_type "integer"
                  remove_newlines true
          • Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}]
                  dbkey "?"
          • Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpz1b2i2gf/job_working_directory/000/56/configs/tmpzq99obtc' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpz1b2i2gf/files/a/9/8/dataset_a9866497-009a-4154-92fc-4bd336dee8a6.dat' '/tmp/tmpz1b2i2gf/job_working_directory/000/56/outputs/dataset_d974ace2-9936-4a08-b1ea-0ff265bd13f9.dat'

                Exit Code:

                • 0

                Standard Output:

                • Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                  Computed new column values for 100.00% of 35 lines written.
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1179e211efbd244d1ea10a55e7"
                  avoid_scientific_notation false
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  error_handling {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
                  ops {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}
      • Step 38: Data Prep Hap1:

        • step_state: scheduled

        • Subworkflow Steps
          • Step 1: gfa_stats:

            • step_state: scheduled
          • Step 2: sort1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpz1b2i2gf/files/2/c/4/dataset_2c4dfce8-1151-4bae-b575-97b8955a06b8.dat' --output='/tmp/tmpz1b2i2gf/job_working_directory/000/35/outputs/dataset_49724b16-85cc-49f5-a626-e5c7b9c97499.dat'    --key=2,2nr   --header 0

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  column "2"
                  column_set []
                  dbkey "?"
                  header_lines "0"
                  order "DESC"
                  style "num"
          • Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpz1b2i2gf/job_working_directory/000/36/configs/tmp9rqxree0' '/tmp/tmpz1b2i2gf/files/4/9/7/dataset_49724b16-85cc-49f5-a626-e5c7b9c97499.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/36/outputs/dataset_fa15a2aa-05c2-4a29-9380-3ac371f0f9fb.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  code "{total += $2; $3 = total}1"
                  dbkey "?"
          • Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • datamash         absmax 3 < /tmp/tmpz1b2i2gf/files/f/a/1/dataset_fa15a2aa-05c2-4a29-9380-3ac371f0f9fb.dat > '/tmp/tmpz1b2i2gf/job_working_directory/000/37/outputs/dataset_4d0faa32-8746-4af3-a3e0-7143ead9d1d4.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  grouping ""
                  header_in false
                  header_out false
                  ignore_case false
                  narm false
                  need_sort false
                  operations [{"__index__": 0, "op_column": "3", "op_name": "absmax"}]
                  print_full_line false
          • Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpz1b2i2gf/files/f/a/1/dataset_fa15a2aa-05c2-4a29-9380-3ac371f0f9fb.dat" "/tmp/tmpz1b2i2gf/job_working_directory/000/38/outputs/dataset_decaefc0-99b9-4682-87ed-6d06c2ed45f6.dat" "1" "yes"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  exp "1"
                  iterate "yes"
          • Step 6: param_value_from_file:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  param_type "integer"
                  remove_newlines true
          • Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}]
                  dbkey "?"
          • Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpz1b2i2gf/job_working_directory/000/57/configs/tmpme5f4m1v' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpz1b2i2gf/files/d/e/c/dataset_decaefc0-99b9-4682-87ed-6d06c2ed45f6.dat' '/tmp/tmpz1b2i2gf/job_working_directory/000/57/outputs/dataset_9bc0ab19-0475-441a-9abd-037194458c10.dat'

                Exit Code:

                • 0

                Standard Output:

                • Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                  Computed new column values for 100.00% of 72 lines written.
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1279e211efbd244d1ea10a55e7"
                  avoid_scientific_notation false
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  error_handling {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
                  ops {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}
      • Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • sed --sandbox -r -f '/tmp/tmpz1b2i2gf/job_working_directory/000/40/configs/tmpwda6pr06' '/tmp/tmpz1b2i2gf/files/6/6/9/dataset_66992275-6ae8-429b-8ad7-ca1c34230474.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/40/outputs/dataset_a09f5ffd-4059-4e6c-85f0-e48eacecd259.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              adv_opts {"__current_case__": 0, "adv_opts_selector": "basic"}
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              code "s/_path//g"
              dbkey "?"
      • Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • sed --sandbox -r -f '/tmp/tmpz1b2i2gf/job_working_directory/000/41/configs/tmptr63kw_o' '/tmp/tmpz1b2i2gf/files/3/2/b/dataset_32b8392c-f388-464a-bdb1-b2a3e7de5efc.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/41/outputs/dataset_19cc3e1e-d017-45cb-a96f-22ec0d45695a.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              adv_opts {"__current_case__": 0, "adv_opts_selector": "basic"}
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              code "s/_path//g"
              dbkey "?"
      • Step 5: Meryl Database:

        • step_state: scheduled
      • Step 41: join1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/join.py' '/tmp/tmpz1b2i2gf/files/1/7/d/dataset_17d31647-1fd0-4c95-9d81-9a6d0e1e4c31.dat' '/tmp/tmpz1b2i2gf/files/1/8/d/dataset_18d9c8e6-9d48-4d4c-bc23-c65e6ef52c60.dat' 1 1 '/tmp/tmpz1b2i2gf/job_working_directory/000/42/outputs/dataset_6bfcebe9-6bd3-44ec-ae4f-a7e8ef130952.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpz1b2i2gf/job_working_directory/000/42/configs/tmpxo9b5aet

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              field1 "1"
              field2 "1"
              fill_empty_columns {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}
              header ""
              partial "-p"
              unmatched "-u"
      • Step 42: Plot Data:

        • step_state: scheduled

        • Subworkflow Steps
          • Step 1: Primary data:

            • step_state: scheduled
          • Step 2: Alternate data:

            • step_state: scheduled
          • Step 11: Size Plot:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cat '/tmp/tmpz1b2i2gf/job_working_directory/000/64/configs/tmp1znbe1ws' && Rscript '/tmp/tmpz1b2i2gf/job_working_directory/000/64/configs/tmp1znbe1ws'

                Exit Code:

                • 0

                Standard Error:

                • Warning message:
                  In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                    OS reports request to set locale to "en_US.UTF-8" cannot be honored
                  Warning message:
                  package ‘ggplot2’ was built under R version 4.1.3 
                  Warning message:
                  Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                  ℹ Please use `linewidth` instead. 
                  

                Standard Output:

                •         options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})
                  
                          loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
                      
                  
                  library(ggplot2)
                  
                  
                          #Choose between automatically scaled x and y axis or user defined
                              gg_scalex = NULL
                              gg_scaley = NULL
                      
                  
                  
                              gg_theme = theme_bw()
                      
                  
                  
                              gg_legend = theme(legend.position="right")
                      
                  
                  input <- read.csv('/tmp/tmpz1b2i2gf/files/c/7/2/dataset_c72783e0-249b-41ae-98d2-325a35e2ff4a.dat', sep='\t', header=TRUE)
                  
                  names(input)[2] <- "xcol"
                  names(input)[3] <- "ycol"
                  
                      gg_facet = NULL
                      gg_factor = aes(colour=factor(factor))
                  
                          gg_line = geom_line(size=1, alpha=1, gg_factor)
                  
                          color_scale = scale_color_brewer(palette='Set1', direction='1')
                  
                      names(input)[1] <- "factor"
                  
                  
                      
                  
                      gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_gridline = NULL
                  
                      gg_point = NULL
                  
                  #this is the actual ggplot command to make the final plot(s)
                  plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                      gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                      gg_axistitle + gg_axistext + gg_plottitle + gg_gridline
                  
                  
                          gg_width <- as.double('6.0')
                          gg_height <- as.double('4.0')
                          gg_unit <- 'in'
                          gg_dpi <- as.double('300.0')
                          gg_add_device <- 'none'
                          output1 <- '/tmp/tmpz1b2i2gf/job_working_directory/000/64/outputs/dataset_ed4a9793-9399-457e-9a3b-f4025e9a0513.dat'
                          output2 <- 'XXXX'
                  
                          ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                          if(gg_add_device != "none"){
                            ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                          }
                      
                          

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  adv {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  out {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}
                  title ""
                  xlab "Scaffold number"
                  xplot "2"
                  ylab "Cumulative Size (Mb)"
                  yplot "3"
          • Step 3: Name of primary assembly:

            • step_state: scheduled
          • Step 4: Name of alternate assembly:

            • step_state: scheduled
          • Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpz1b2i2gf/files/9/b/c/dataset_9bc0ab19-0475-441a-9abd-037194458c10.dat" "/tmp/tmpz1b2i2gf/job_working_directory/000/58/outputs/dataset_5c5ae31e-87dc-4049-a7de-94d729615b3a.dat" "Hap1" "no"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  exp "Hap1"
                  iterate "no"
          • Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpz1b2i2gf/files/d/9/7/dataset_d974ace2-9936-4a08-b1ea-0ff265bd13f9.dat" "/tmp/tmpz1b2i2gf/job_working_directory/000/59/outputs/dataset_c8f8ea4e-8a9c-4fdc-8189-40151b11b217.dat" "Hap2" "no"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  exp "Hap2"
                  iterate "no"
          • Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cat '/tmp/tmpz1b2i2gf/files/5/c/5/dataset_5c5ae31e-87dc-4049-a7de-94d729615b3a.dat' >> '/tmp/tmpz1b2i2gf/job_working_directory/000/60/outputs/dataset_0279a111-762d-4d15-a413-45778bc012d8.dat' && cat '/tmp/tmpz1b2i2gf/files/c/8/f/dataset_c8f8ea4e-8a9c-4fdc-8189-40151b11b217.dat' >> '/tmp/tmpz1b2i2gf/job_working_directory/000/60/outputs/dataset_0279a111-762d-4d15-a413-45778bc012d8.dat' && exit 0

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  queries [{"__index__": 0, "inputs2": {"values": [{"id": 107, "src": "hda"}]}}]
          • Step 8: Cut1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpz1b2i2gf/files/0/2/7/dataset_0279a111-762d-4d15-a413-45778bc012d8.dat' 'c8,c5,c6' T '/tmp/tmpz1b2i2gf/job_working_directory/000/61/outputs/dataset_643e251a-f99a-46a3-929c-596b24892e18.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  columnList "c8,c5,c6"
                  dbkey "?"
                  delimiter "T"
          • Step 9: Cut1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl '/tmp/tmpz1b2i2gf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpz1b2i2gf/files/0/2/7/dataset_0279a111-762d-4d15-a413-45778bc012d8.dat' 'c8,c4,c7' T '/tmp/tmpz1b2i2gf/job_working_directory/000/62/outputs/dataset_c72783e0-249b-41ae-98d2-325a35e2ff4a.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  columnList "c8,c4,c7"
                  dbkey "?"
                  delimiter "T"
          • Step 10: Nx Plot:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cat '/tmp/tmpz1b2i2gf/job_working_directory/000/63/configs/tmpk_hunc7l' && Rscript '/tmp/tmpz1b2i2gf/job_working_directory/000/63/configs/tmpk_hunc7l'

                Exit Code:

                • 0

                Standard Error:

                • Warning message:
                  In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                    OS reports request to set locale to "en_US.UTF-8" cannot be honored
                  Warning message:
                  package ‘ggplot2’ was built under R version 4.1.3 
                  Warning message:
                  Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                  ℹ Please use `linewidth` instead. 
                  

                Standard Output:

                •         options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})
                  
                          loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
                      
                  
                  library(ggplot2)
                  
                  
                          #Choose between automatically scaled x and y axis or user defined
                              gg_scalex = NULL
                              gg_scaley = NULL
                      
                  
                  
                              gg_theme = theme_bw()
                      
                  
                  
                              gg_legend = theme(legend.position="right")
                      
                  
                  input <- read.csv('/tmp/tmpz1b2i2gf/files/6/4/3/dataset_643e251a-f99a-46a3-929c-596b24892e18.dat', sep='\t', header=TRUE)
                  
                  names(input)[2] <- "xcol"
                  names(input)[3] <- "ycol"
                  
                      gg_facet = NULL
                      gg_factor = aes(colour=factor(factor))
                  
                          gg_line = geom_line(size=1, alpha=1, gg_factor)
                  
                          color_scale = scale_color_brewer(palette='Set1', direction='1')
                  
                      names(input)[1] <- "factor"
                  
                  
                      
                  
                      gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))
                  
                      gg_gridline = NULL
                  
                      gg_point = NULL
                  
                  #this is the actual ggplot command to make the final plot(s)
                  plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                      gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                      gg_axistitle + gg_axistext + gg_plottitle + gg_gridline
                  
                  
                          gg_width <- as.double('6.0')
                          gg_height <- as.double('4.0')
                          gg_unit <- 'in'
                          gg_dpi <- as.double('300.0')
                          gg_add_device <- 'none'
                          output1 <- '/tmp/tmpz1b2i2gf/job_working_directory/000/63/outputs/dataset_42c280d8-5b5f-4ae7-bf52-3048d1a94f0a.dat'
                          output2 <- 'XXXX'
                  
                          ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                          if(gg_add_device != "none"){
                            ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                          }
                      
                          

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "input"
                  __workflow_invocation_uuid__ "ffe15c1379e211efbd244d1ea10a55e7"
                  adv {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
                  chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  out {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}
                  title ""
                  xlab "x"
                  xplot "2"
                  ylab "Nx (Mb)"
                  yplot "3"
      • Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • busco --in '/tmp/tmpz1b2i2gf/files/a/0/9/dataset_a09f5ffd-4059-4e6c-85f0-e48eacecd259.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'    && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

            Exit Code:

            • 0

            Standard Error:

            • 2024-09-23 20:02:53 ERROR:	
              Warning message:
              package ‘ggplot2’ was built under R version 4.2.3 
              Warning message:
              The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
              ℹ Please use the `linewidth` argument instead. 
              
              

            Standard Output:

            • 2024-09-23 19:43:30 INFO:	***** Start a BUSCO v5.5.0 analysis, current time: 09/23/2024 19:43:30 *****
              2024-09-23 19:43:30 INFO:	Configuring BUSCO with local environment
              2024-09-23 19:43:30 INFO:	Mode is genome
              2024-09-23 19:43:38 INFO:	Input file is /tmp/tmpz1b2i2gf/files/a/0/9/dataset_a09f5ffd-4059-4e6c-85f0-e48eacecd259.dat
              2024-09-23 19:43:38 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:38 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:39 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
              2024-09-23 19:43:39 INFO:	Running 1 job(s) on bbtools, starting at 09/23/2024 19:43:39
              2024-09-23 19:43:40 INFO:	[bbtools]	1 of 1 task(s) completed
              2024-09-23 19:43:40 INFO:	Running 1 job(s) on metaeuk, starting at 09/23/2024 19:43:40
              2024-09-23 19:48:19 INFO:	[metaeuk]	1 of 1 task(s) completed
              2024-09-23 19:48:20 INFO:	***** Run HMMER on gene sequences *****
              2024-09-23 19:48:21 INFO:	Running 3354 job(s) on hmmsearch, starting at 09/23/2024 19:48:21
              2024-09-23 19:49:00 INFO:	[hmmsearch]	336 of 3354 task(s) completed
              2024-09-23 19:49:36 INFO:	[hmmsearch]	671 of 3354 task(s) completed
              2024-09-23 19:50:12 INFO:	[hmmsearch]	1007 of 3354 task(s) completed
              2024-09-23 19:50:47 INFO:	[hmmsearch]	1342 of 3354 task(s) completed
              2024-09-23 19:51:22 INFO:	[hmmsearch]	1677 of 3354 task(s) completed
              2024-09-23 19:51:56 INFO:	[hmmsearch]	2013 of 3354 task(s) completed
              2024-09-23 19:52:30 INFO:	[hmmsearch]	2348 of 3354 task(s) completed
              2024-09-23 19:53:04 INFO:	[hmmsearch]	2684 of 3354 task(s) completed
              2024-09-23 19:53:39 INFO:	[hmmsearch]	3019 of 3354 task(s) completed
              2024-09-23 19:54:19 INFO:	[hmmsearch]	3354 of 3354 task(s) completed
              2024-09-23 19:54:21 INFO:	Validating exons and removing overlapping matches
              2024-09-23 19:54:22 INFO:	0 candidate overlapping regions found
              2024-09-23 19:54:22 INFO:	26 exons in total
              2024-09-23 19:54:22 INFO:	Extracting missing and fragmented buscos from the file refseq_db.faa...
              2024-09-23 19:56:40 INFO:	Running 1 job(s) on metaeuk, starting at 09/23/2024 19:56:40
              2024-09-23 20:02:04 INFO:	[metaeuk]	1 of 1 task(s) completed
              2024-09-23 20:02:05 INFO:	***** Run HMMER on gene sequences *****
              2024-09-23 20:02:05 INFO:	Running 3337 job(s) on hmmsearch, starting at 09/23/2024 20:02:05
              2024-09-23 20:02:10 INFO:	[hmmsearch]	334 of 3337 task(s) completed
              2024-09-23 20:02:14 INFO:	[hmmsearch]	668 of 3337 task(s) completed
              2024-09-23 20:02:18 INFO:	[hmmsearch]	1002 of 3337 task(s) completed
              2024-09-23 20:02:22 INFO:	[hmmsearch]	1335 of 3337 task(s) completed
              2024-09-23 20:02:26 INFO:	[hmmsearch]	1669 of 3337 task(s) completed
              2024-09-23 20:02:31 INFO:	[hmmsearch]	2003 of 3337 task(s) completed
              2024-09-23 20:02:35 INFO:	[hmmsearch]	2336 of 3337 task(s) completed
              2024-09-23 20:02:39 INFO:	[hmmsearch]	2670 of 3337 task(s) completed
              2024-09-23 20:02:43 INFO:	[hmmsearch]	3004 of 3337 task(s) completed
              2024-09-23 20:02:47 INFO:	[hmmsearch]	3337 of 3337 task(s) completed
              2024-09-23 20:02:50 INFO:	Validating exons and removing overlapping matches
              2024-09-23 20:02:50 INFO:	0 candidate overlapping regions found
              2024-09-23 20:02:50 INFO:	24 exons in total
              2024-09-23 20:02:50 INFO:	Results:	C:0.5%[S:0.5%,D:0.0%],F:0.2%,M:99.3%,n:3354	   
              
              2024-09-23 20:02:51 INFO:	
              
              	---------------------------------------------------
              	|Results from dataset vertebrata_odb10             |
              	---------------------------------------------------
              	|C:0.5%[S:0.5%,D:0.0%],F:0.2%,M:99.3%,n:3354       |
              	|17	Complete BUSCOs (C)                        |
              	|16	Complete and single-copy BUSCOs (S)        |
              	|1	Complete and duplicated BUSCOs (D)         |
              	|6	Fragmented BUSCOs (F)                      |
              	|3331	Missing BUSCOs (M)                         |
              	|3354	Total BUSCO groups searched                |
              	---------------------------------------------------
              2024-09-23 20:02:51 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1152 seconds
              
              ***** Summary of warnings: *****
              2024-09-23 19:43:38 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:38 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_met
              
              2024-09-23 20:02:51 INFO:	Results written in /tmp/tmpz1b2i2gf/job_working_directory/000/43/working/busco_galaxy
              2024-09-23 20:02:51 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html
              
              2024-09-23 20:02:51 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
              total 136
              drwxr-xr-x 5 1001 127  4096 Sep 23 19:43 busco_sequences
              -rw-r--r-- 1 1001 127 73043 Sep 23 20:02 full_table.tsv
              drwxr-xr-x 4 1001 127  4096 Sep 23 19:54 hmmer_output
              drwxr-xr-x 4 1001 127  4096 Sep 23 20:02 metaeuk_output
              -rw-r--r-- 1 1001 127 42736 Sep 23 20:02 missing_busco_list.tsv
              -rw-r--r-- 1 1001 127  2215 Sep 23 20:02 short_summary.json
              -rw-r--r-- 1 1001 127   882 Sep 23 20:02 short_summary.txt
              2024-09-23 20:02:51 INFO:	****************** Start plot generation at 09/23/2024 20:02:51 ******************
              2024-09-23 20:02:51 INFO:	Load data ...
              2024-09-23 20:02:51 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
              2024-09-23 20:02:51 INFO:	Generate the R code ...
              2024-09-23 20:02:51 INFO:	Run the R code ...
              2024-09-23 20:02:53 INFO:	
              [1] "Plotting the figure ..."
              [1] "Done"
              
              2024-09-23 20:02:53 INFO:	Plot generation done. Total running time: 2.3961501121520996 seconds
              2024-09-23 20:02:53 INFO:	Results written in BUSCO_summaries/
              
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              adv {"contig_break": "10", "evalue": "0.001", "limit": "3"}
              busco_mode {"__current_case__": 0, "miniprot": false, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "no"}}
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              lineage {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}
              lineage_conditional {"__current_case__": 0, "cached_db": "v5", "selector": "cached"}
              outputs ["short_summary", "missing", "image", "gff"]
      • Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpz1b2i2gf/files/6/1/5/dataset_6152bff9-2703-489e-8be9-faf940fce054.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpz1b2i2gf/files/1/9/c/dataset_19cc3e1e-d017-45cb-a96f-22ec0d45695a.dat' assembly_01.fasta && ln -s '/tmp/tmpz1b2i2gf/files/a/0/9/dataset_a09f5ffd-4059-4e6c-85f0-e48eacecd259.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpz1b2i2gf/job_working_directory/000/44/outputs/dataset_07578bdf-76a8-4b0f-ad14-2d4a1d16c39f.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              label "output_merqury"
              mode {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 51, "src": "hda"}]}, "assembly_02": {"values": [{"id": 50, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"}
              output_add_headers true
              output_selector ["qv", "plots", "stats", "log", "hist"]
      • Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.5.0+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • busco --in '/tmp/tmpz1b2i2gf/files/1/9/c/dataset_19cc3e1e-d017-45cb-a96f-22ec0d45695a.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'    && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

            Exit Code:

            • 0

            Standard Error:

            • 2024-09-23 20:05:07 ERROR:	
              Warning message:
              package ‘ggplot2’ was built under R version 4.2.3 
              Warning message:
              The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
              ℹ Please use the `linewidth` argument instead. 
              
              

            Standard Output:

            • 2024-09-23 19:43:30 INFO:	***** Start a BUSCO v5.5.0 analysis, current time: 09/23/2024 19:43:30 *****
              2024-09-23 19:43:30 INFO:	Configuring BUSCO with local environment
              2024-09-23 19:43:30 INFO:	Mode is genome
              2024-09-23 19:43:38 INFO:	Input file is /tmp/tmpz1b2i2gf/files/1/9/c/dataset_19cc3e1e-d017-45cb-a96f-22ec0d45695a.dat
              2024-09-23 19:43:38 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:38 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:39 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
              2024-09-23 19:43:39 INFO:	Running 1 job(s) on bbtools, starting at 09/23/2024 19:43:39
              2024-09-23 19:43:40 INFO:	[bbtools]	1 of 1 task(s) completed
              2024-09-23 19:43:40 INFO:	Running 1 job(s) on metaeuk, starting at 09/23/2024 19:43:40
              2024-09-23 19:49:12 INFO:	[metaeuk]	1 of 1 task(s) completed
              2024-09-23 19:49:13 INFO:	***** Run HMMER on gene sequences *****
              2024-09-23 19:49:13 INFO:	Running 3354 job(s) on hmmsearch, starting at 09/23/2024 19:49:13
              2024-09-23 19:49:19 INFO:	[hmmsearch]	336 of 3354 task(s) completed
              2024-09-23 19:49:36 INFO:	[hmmsearch]	671 of 3354 task(s) completed
              2024-09-23 19:50:12 INFO:	[hmmsearch]	1007 of 3354 task(s) completed
              2024-09-23 19:50:47 INFO:	[hmmsearch]	1342 of 3354 task(s) completed
              2024-09-23 19:51:22 INFO:	[hmmsearch]	1677 of 3354 task(s) completed
              2024-09-23 19:51:56 INFO:	[hmmsearch]	2013 of 3354 task(s) completed
              2024-09-23 19:52:30 INFO:	[hmmsearch]	2348 of 3354 task(s) completed
              2024-09-23 19:53:04 INFO:	[hmmsearch]	2684 of 3354 task(s) completed
              2024-09-23 19:53:39 INFO:	[hmmsearch]	3019 of 3354 task(s) completed
              2024-09-23 19:54:19 INFO:	[hmmsearch]	3354 of 3354 task(s) completed
              2024-09-23 19:54:22 INFO:	Validating exons and removing overlapping matches
              2024-09-23 19:54:22 INFO:	0 candidate overlapping regions found
              2024-09-23 19:54:22 INFO:	50 exons in total
              2024-09-23 19:54:22 INFO:	Extracting missing and fragmented buscos from the file refseq_db.faa...
              2024-09-23 19:56:39 INFO:	Running 1 job(s) on metaeuk, starting at 09/23/2024 19:56:39
              2024-09-23 20:04:15 INFO:	[metaeuk]	1 of 1 task(s) completed
              2024-09-23 20:04:16 INFO:	***** Run HMMER on gene sequences *****
              2024-09-23 20:04:16 INFO:	Running 3320 job(s) on hmmsearch, starting at 09/23/2024 20:04:16
              2024-09-23 20:04:21 INFO:	[hmmsearch]	332 of 3320 task(s) completed
              2024-09-23 20:04:25 INFO:	[hmmsearch]	664 of 3320 task(s) completed
              2024-09-23 20:04:30 INFO:	[hmmsearch]	996 of 3320 task(s) completed
              2024-09-23 20:04:34 INFO:	[hmmsearch]	1328 of 3320 task(s) completed
              2024-09-23 20:04:38 INFO:	[hmmsearch]	1660 of 3320 task(s) completed
              2024-09-23 20:04:43 INFO:	[hmmsearch]	1992 of 3320 task(s) completed
              2024-09-23 20:04:47 INFO:	[hmmsearch]	2324 of 3320 task(s) completed
              2024-09-23 20:04:52 INFO:	[hmmsearch]	2656 of 3320 task(s) completed
              2024-09-23 20:04:56 INFO:	[hmmsearch]	2988 of 3320 task(s) completed
              2024-09-23 20:05:00 INFO:	[hmmsearch]	3320 of 3320 task(s) completed
              2024-09-23 20:05:04 INFO:	Validating exons and removing overlapping matches
              2024-09-23 20:05:04 INFO:	0 candidate overlapping regions found
              2024-09-23 20:05:04 INFO:	52 exons in total
              2024-09-23 20:05:04 INFO:	Results:	C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354	   
              
              2024-09-23 20:05:04 INFO:	
              
              	---------------------------------------------------
              	|Results from dataset vertebrata_odb10             |
              	---------------------------------------------------
              	|C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354       |
              	|34	Complete BUSCOs (C)                        |
              	|33	Complete and single-copy BUSCOs (S)        |
              	|1	Complete and duplicated BUSCOs (D)         |
              	|13	Fragmented BUSCOs (F)                      |
              	|3307	Missing BUSCOs (M)                         |
              	|3354	Total BUSCO groups searched                |
              	---------------------------------------------------
              2024-09-23 20:05:04 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1286 seconds
              
              ***** Summary of warnings: *****
              2024-09-23 19:43:38 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_met
              2024-09-23 19:43:38 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_met
              
              2024-09-23 20:05:04 INFO:	Results written in /tmp/tmpz1b2i2gf/job_working_directory/000/45/working/busco_galaxy
              2024-09-23 20:05:04 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html
              
              2024-09-23 20:05:04 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
              total 140
              drwxr-xr-x 5 1001 127  4096 Sep 23 19:43 busco_sequences
              -rw-r--r-- 1 1001 127 76245 Sep 23 20:05 full_table.tsv
              drwxr-xr-x 4 1001 127  4096 Sep 23 19:54 hmmer_output
              drwxr-xr-x 4 1001 127  4096 Sep 23 20:05 metaeuk_output
              -rw-r--r-- 1 1001 127 42431 Sep 23 20:05 missing_busco_list.tsv
              -rw-r--r-- 1 1001 127  2215 Sep 23 20:05 short_summary.json
              -rw-r--r-- 1 1001 127   883 Sep 23 20:05 short_summary.txt
              2024-09-23 20:05:05 INFO:	****************** Start plot generation at 09/23/2024 20:05:05 ******************
              2024-09-23 20:05:05 INFO:	Load data ...
              2024-09-23 20:05:05 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
              2024-09-23 20:05:05 INFO:	Generate the R code ...
              2024-09-23 20:05:05 INFO:	Run the R code ...
              2024-09-23 20:05:07 INFO:	
              [1] "Plotting the figure ..."
              [1] "Done"
              
              2024-09-23 20:05:07 INFO:	Plot generation done. Total running time: 2.2009379863739014 seconds
              2024-09-23 20:05:07 INFO:	Results written in BUSCO_summaries/
              
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              adv {"contig_break": "10", "evalue": "0.001", "limit": "3"}
              busco_mode {"__current_case__": 0, "miniprot": false, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "no"}}
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              lineage {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}
              lineage_conditional {"__current_case__": 0, "cached_db": "v5", "selector": "cached"}
              outputs ["short_summary", "missing", "image", "gff"]
      • Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cut --complement -f '3' '/tmp/tmpz1b2i2gf/files/6/b/f/dataset_6bfcebe9-6bd3-44ec-ae4f-a7e8ef130952.dat' > '/tmp/tmpz1b2i2gf/job_working_directory/000/46/outputs/dataset_3c9718ab-a5c1-4b9b-a7ec-8982cb506c93.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              complement "--complement"
              cut_type_options {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}
              dbkey "?"
      • Step 47: output_merqury.spectra-cn.fl:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 8, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}
      • Step 48: output_merqury.spectra-asm.fl:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 8, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}
      • Step 49: merqury_qv:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 7, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}
      • Step 50: output_merqury.assembly_01.spectra-cn.fl:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 8, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}
      • Step 6: Database for Busco Lineage:

        • step_state: scheduled
      • Step 51: merqury_stats:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 9, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}
      • Step 52: output_merqury.assembly_02.spectra-cn.fl:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              input {"values": [{"id": 8, "src": "hdca"}]}
              which {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"}
      • Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/fbf99087e067/text_processing/find_and_replace' -o '/tmp/tmpz1b2i2gf/job_working_directory/000/47/outputs/dataset_2086a7b9-08fa-4664-a92f-9938b6c4995f.dat' -g     '#' 'Number of' '/tmp/tmpz1b2i2gf/files/3/c/9/dataset_3c9718ab-a5c1-4b9b-a7ec-8982cb506c93.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ffe15c1079e211efbd244d1ea10a55e7"
              chromInfo "/tmp/tmpz1b2i2gf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              find_and_replace [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]
      • Step 7: Lineage:

        • step_state: scheduled
      • Step 8: Name for Haplotype 1:

        • step_state: scheduled
      • Step 9: Name for Haplotype 2:

        • step_state: scheduled
      • Step 10: Bits for bloom filter:

        • step_state: scheduled
    • Other invocation details
      • history_id

        • 0ecb802b1b20be28
      • history_state

        • ok
      • invocation_id

        • 0ecb802b1b20be28
      • invocation_state

        • scheduled
      • workflow_id

        • 7c757edc7633567b

@lldelisle

Copy link
Copy Markdown
Contributor
  • ❌ bacterial_genome_assembly.ga_0

    Problems:

    • Output with path /tmp/tmp5y2qy5nf/shovill_contigs_graph__d6f87994-3dd9-415d-9d12-c02232e4a389 different than expected
      Expected 18+-0 lines in the output found 697
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: Input adapter trimmed sequence reads (forward):

        • step_state: scheduled
      • Step 2: Input adapter trimmed sequence reads (reverse):

        • step_state: scheduled
      • Step 3: shovill_genome_assembly:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cp '/tmp/tmpyvfjboor/files/4/4/9/dataset_4492e6fa-b9c2-4092-9f54-074186a55740.dat' fastq_r1.'fastqsanger.gz' && cp '/tmp/tmpyvfjboor/files/9/4/2/dataset_942dd72b-8156-49c6-9614-187e47876ae6.dat' fastq_r2.'fastqsanger.gz' &&  GALAXY_MEMORY_GB=$((${GALAXY_MEMORY_MB:-4096}/1024)) && SHOVILL_RAM=${SHOVILL_RAM:-${GALAXY_MEMORY_GB}} &&  shovill --outdir 'out' --cpus ${GALAXY_SLOTS:-1} --ram ${SHOVILL_RAM:-4} --R1 'fastq_r1.fastqsanger.gz' --R2 'fastq_r2.fastqsanger.gz'  --namefmt 'contig%05d' --depth '100' --minlen 0 --mincov 2 --assembler spades --keepfiles

            Exit Code:

            • 0

            Standard Error:

            • [shovill] Hello stranger
              [shovill] You ran: /usr/local/bin/shovill --outdir out --cpus 1 --ram 4 --R1 fastq_r1.fastqsanger.gz --R2 fastq_r2.fastqsanger.gz --namefmt contig%05d --depth 100 --minlen 0 --mincov 2 --assembler spades --keepfiles
              [shovill] This is shovill 1.1.0
              [shovill] Written by Torsten Seemann
              [shovill] Homepage is https://github.com/tseemann/shovill
              [shovill] Operating system is linux
              [shovill] Perl version is v5.26.2
              [shovill] Machine has 4 CPU cores and 15.62 GB RAM
              [shovill] Using bwa - /usr/local/bin/bwa | Version: 0.7.17-r1188
              [shovill] Using flash - /usr/local/bin/flash | FLASH v1.2.11
              [shovill] Using java - /usr/local/bin/java | openjdk version "11.0.1" 2018-10-16 LTS
              [shovill] Using kmc - /usr/local/bin/kmc | K-Mer Counter (KMC) ver. 3.1.1 (2019-05-19)
              [shovill] Using lighter - /usr/local/bin/lighter | Lighter v1.1.2
              [shovill] Using megahit - /usr/local/bin/megahit | MEGAHIT v1.2.9
              [shovill] Using megahit_toolkit - /usr/local/bin/megahit_toolkit | v1.2.9
              [shovill] Using pigz - /usr/local/bin/pigz | pigz 2.6
              [shovill] Using pilon - /usr/local/bin/pilon | Pilon version 1.23 Mon Nov 26 16:04:05 2018 -0500
              [shovill] Using samclip - /usr/local/bin/samclip | samclip 0.4.0
              [shovill] Using samtools - /usr/local/bin/samtools | Version: 1.12 (using htslib 1.12)
              [shovill] Using seqtk - /usr/local/bin/seqtk | Version: 1.3-r106
              [shovill] Using skesa - /usr/local/bin/skesa | SKESA 2.4.0
              [shovill] Using spades.py - /usr/local/bin/spades.py | SPAdes genome assembler v3.14.1
              [shovill] Using trimmomatic - /usr/local/bin/trimmomatic | 0.39
              [shovill] Using velvetg - /usr/local/bin/velvetg | Version 1.2.10
              [shovill] Using velveth - /usr/local/bin/velveth | Version 1.2.10
              [shovill] Found spades version: 003014000
              [shovill] Will use spades 003014000 options: --isolate and --merged
              [shovill] Using tempdir: /tmp/tmpyvfjboor/tmp
              [shovill] Changing into folder: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out
              [shovill] Collecting raw read statistics with 'seqtk'
              [shovill] Running: seqtk fqchk -q3 \/tmp\/tmpyvfjboor\/job_working_directory\/000\/3\/working\/fastq_r1\.fastqsanger\.gz >/tmp/tmpyvfjboor/tmp/_0rH7W3mGH 2>&1 | sed 's/^/[seqtk] /' | tee -a shovill.log
              [shovill] Read stats: avg_len = 201
              [shovill] Read stats: max_len = 301
              [shovill] Read stats: min_len = 35
              [shovill] Read stats: total_bp = 59339800
              [shovill] Estimating genome size by counting unqiue 21-mers > frequency 10 
              [shovill] Running: kmc -sm -m2 -t1 -k21 -ci10 \/tmp\/tmpyvfjboor\/job_working_directory\/000\/3\/working\/fastq_r1\.fastqsanger\.gz /tmp/tmpyvfjboor/tmp/b8crm4_oBV/kmc /tmp/tmpyvfjboor/tmp/b8crm4_oBV 2>&1 | sed 's/^/[kmc] /' | tee -a shovill.log
              [shovill] Using genome size 932868 bp
              [shovill] Estimated sequencing depth: 63 x
              [shovill] No read depth reduction requested or necessary.
              [shovill] Appending -Xmx4g to _JAVA_OPTIONS
              [shovill] Running: ln -sf \/tmp\/tmpyvfjboor\/job_working_directory\/000\/3\/working\/fastq_r1\.fastqsanger\.gz R1.fq.gz 2>&1 | sed 's/^/[ln] /' | tee -a shovill.log
              [shovill] Running: ln -sf \/tmp\/tmpyvfjboor\/job_working_directory\/000\/3\/working\/fastq_r2\.fastqsanger\.gz R2.fq.gz 2>&1 | sed 's/^/[ln] /' | tee -a shovill.log
              [shovill] Average read length looks like 201 bp
              [shovill] Automatically setting --minlen to 100
              [shovill] Setting k-mer range to (31 .. 127)
              [shovill] Estimated K-mers: 31 55 79 103 127 [kn=5, ks=24, kmin=31, kmax=127]
              [shovill] Using kmers: 31,55,79,103,127
              [shovill] Correcting reads with 'Lighter'
              [shovill] Running: lighter -od . -r R1.fq.gz -r R2.fq.gz -K 32 932868 -t 1 -maxcor 1 2>&1 | sed 's/^/[lighter] /' | tee -a shovill.log
              [shovill] Overlapping/stitching PE reads with 'FLASH'
              [shovill] Running: flash -m 20 -M 301 -d . -o flash -z -t 1 R1.cor.fq.gz R2.cor.fq.gz 2>&1 | sed 's/^//' | tee -a shovill.log
              [shovill] Assembling reads with 'spades'
              [shovill] Running: spades.py -1 flash.notCombined_1.fastq.gz -2 flash.notCombined_2.fastq.gz --isolate --threads 1 --memory 4 -o spades --tmp-dir /tmp/tmpyvfjboor/tmp -k 31,55,79,103,127  --merged flash.extendedFrags.fastq.gz 2>&1 | sed 's/^/[spades] /' | tee -a shovill.log
              [shovill] Checking for assembly errors in spades.fasta
              [shovill] Running: bwa index spades.fasta 2>&1 | sed 's/^/[bwa-index] /' | tee -a shovill.log
              [shovill] Running: samtools faidx spades.fasta 2>&1 | sed 's/^/[faidx] /' | tee -a shovill.log
              [shovill] Running: (bwa mem -v 3 -x intractg -t 1 spades.fasta R1.fq.gz R2.fq.gz | samclip --ref spades.fasta.fai | samtools sort --threads 1 -m 2048m --reference spades.fasta -T /tmp/tmpyvfjboor/tmp -o shovill.bam) 2>&1 | sed 's/^/[bwa+samtools-sort] /' | tee -a shovill.log
              [shovill] Running: samtools index shovill.bam 2>&1 | sed 's/^/[samtools-index] /' | tee -a shovill.log
              [shovill] Correcting errors in spades.fasta
              [shovill] Running: pilon --genome spades.fasta --frags shovill.bam --minmq 60 --minqual 3 --fix bases --output pilon --threads 1 --changes --mindepth 0.25 2>&1 | sed 's/^/[pilon] /' | tee -a shovill.log
              [shovill] Repaired 93 contigs from spades.fasta at 1063 positions.
              [shovill] Removing homopolymer-128G contig: NODE_154_length_128_cov_298.000000_pilon
              [shovill] Assembly is 3028158, estimated genome size was 932868 (+224.61%)
              [shovill] Using genome graph file 'spades/assembly_graph_with_scaffolds.gfa' => 'contigs.gfa'
              [shovill] Walltime used: 3 min 11 sec
              [shovill] Results in: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out
              [shovill] Final assembly graph: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/contigs.gfa
              [shovill] Final assembly contigs: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/contigs.fa
              [shovill] It contains 155 (min=100) contigs totalling 3028158 bp.
              [shovill] More correct contigs is better than fewer wrong contigs.
              [shovill] Done.
              

            Standard Output:

            • [kmc] ***********************
              [kmc] 
              Stage 1: 0%
              Stage 1: 100%
              [kmc] 
              Stage 2: 0%
              Stage 2: 1%
              Stage 2: 2%
              Stage 2: 4%
              Stage 2: 5%
              Stage 2: 6%
              Stage 2: 8%
              Stage 2: 9%
              Stage 2: 10%
              Stage 2: 12%
              Stage 2: 13%
              Stage 2: 14%
              Stage 2: 15%
              Stage 2: 17%
              Stage 2: 18%
              Stage 2: 19%
              Stage 2: 20%
              Stage 2: 21%
              Stage 2: 23%
              Stage 2: 24%
              Stage 2: 25%
              Stage 2: 26%
              Stage 2: 27%
              Stage 2: 29%
              Stage 2: 30%
              Stage 2: 31%
              Stage 2: 32%
              Stage 2: 33%
              Stage 2: 34%
              Stage 2: 35%
              Stage 2: 37%
              Stage 2: 38%
              Stage 2: 39%
              Stage 2: 40%
              Stage 2: 41%
              Stage 2: 42%
              Stage 2: 43%
              Stage 2: 44%
              Stage 2: 45%
              Stage 2: 46%
              Stage 2: 47%
              Stage 2: 48%
              Stage 2: 49%
              Stage 2: 50%
              Stage 2: 51%
              Stage 2: 52%
              Stage 2: 53%
              Stage 2: 54%
              Stage 2: 55%
              Stage 2: 56%
              Stage 2: 57%
              Stage 2: 58%
              Stage 2: 59%
              Stage 2: 60%
              Stage 2: 61%
              Stage 2: 62%
              Stage 2: 63%
              Stage 2: 64%
              Stage 2: 65%
              Stage 2: 66%
              Stage 2: 67%
              Stage 2: 68%
              Stage 2: 69%
              Stage 2: 70%
              Stage 2: 71%
              Stage 2: 72%
              Stage 2: 73%
              Stage 2: 74%
              Stage 2: 75%
              Stage 2: 76%
              Stage 2: 77%
              Stage 2: 78%
              Stage 2: 79%
              Stage 2: 80%
              Stage 2: 81%
              Stage 2: 82%
              Stage 2: 83%
              Stage 2: 84%
              Stage 2: 85%
              Stage 2: 86%
              Stage 2: 87%
              Stage 2: 88%
              Stage 2: 89%
              Stage 2: 90%
              Stage 2: 91%
              Stage 2: 92%
              Stage 2: 93%
              Stage 2: 94%
              Stage 2: 95%
              Stage 2: 96%
              Stage 2: 97%
              Stage 2: 98%
              Stage 2: 99%
              Stage 2: 100%
              [kmc] 
              [kmc] 1st stage: 3.8148s
              [kmc] 2nd stage: 8.115s
              [kmc] 3rd stage: 0.00457s
              [kmc] Total    : 11.9344s
              [kmc] Tmp size : 33MB
              [kmc] Tmp size strict memory : 0MB
              [kmc] Tmp total: 33MB
              [kmc] 
              [kmc] Stats:
              [kmc]    No. of k-mers below min. threshold :      3020760
              [kmc]    No. of k-mers above max. threshold :            0
              [kmc]    No. of unique k-mers               :      3953628
              [kmc]    No. of unique counted k-mers       :       932868
              [kmc]    Total no. of k-mers                :     26713100
              [kmc]    Total no. of reads                 :       147840
              [kmc]    Total no. of super-k-mers          :      4068972
              [lighter] [2024-09-23 19:35:03] =============Start====================
              [lighter] [2024-09-23 19:35:03] Scanning the input files to infer alpha(sampling rate)
              [lighter] [2024-09-23 19:35:04] Average coverage is 63.493 and alpha is 0.110
              [lighter] [2024-09-23 19:35:04] Bad quality threshold is ")"
              [lighter] [2024-09-23 19:35:06] Finish sampling kmers
              [lighter] [2024-09-23 19:35:06] Bloom filter A's false positive rate: 0.161268
              [lighter] [2024-09-23 19:35:11] Finish storing trusted kmers
              [lighter] [2024-09-23 19:35:16] Finish error correction
              [lighter] Processed 295680 reads:
              [lighter] 	217994 are error-free
              [lighter] 	Corrected 87725 bases(1.129225 corrections for reads with errors)
              [lighter] 	Trimmed 0 reads with average trimmed bases 0.000000
              [lighter] 	Discard 0 reads
              [FLASH] Starting FLASH v1.2.11
              [FLASH] Fast Length Adjustment of SHort reads
              [FLASH]  
              [FLASH] Input files:
              [FLASH]     R1.cor.fq.gz
              [FLASH]     R2.cor.fq.gz
              [FLASH]  
              [FLASH] Output files:
              [FLASH]     ./flash.extendedFrags.fastq.gz
              [FLASH]     ./flash.notCombined_1.fastq.gz
              [FLASH]     ./flash.notCombined_2.fastq.gz
              [FLASH]     ./flash.hist
              [FLASH]     ./flash.histogram
              [FLASH]  
              [FLASH] Parameters:
              [FLASH]     Min overlap:           20
              [FLASH]     Max overlap:           301
              [FLASH]     Max mismatch density:  0.250000
              [FLASH]     Allow "outie" pairs:   false
              [FLASH]     Cap mismatch quals:    false
              [FLASH]     Combiner threads:      1
              [FLASH]     Input format:          FASTQ, phred_offset=33
              [FLASH]     Output format:         FASTQ, phred_offset=33, gzip
              [FLASH]  
              [FLASH] Starting reader and writer threads
              [FLASH] Starting 1 combiner threads
              [FLASH] Processed 25000 read pairs
              [FLASH] Processed 50000 read pairs
              [FLASH] Processed 75000 read pairs
              [FLASH] Processed 100000 read pairs
              [FLASH] Processed 125000 read pairs
              [FLASH] Processed 147840 read pairs
              [FLASH]  
              [FLASH] Read combination statistics:
              [FLASH]     Total pairs:      147840
              [FLASH]     Combined pairs:   143166
              [FLASH]     Uncombined pairs: 4674
              [FLASH]     Percent combined: 96.84%
              [FLASH]  
              [FLASH] Writing histogram files.
              [FLASH]  
              [FLASH] FLASH v1.2.11 complete!
              [FLASH] 12.092 seconds elapsed
              [spades] Command line: /usr/local/bin/spades.py	-1	/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_1.fastq.gz	-2	/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_2.fastq.gz	--isolate	--threads	1	--memory	4	-o	/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades	--tmp-dir	/tmp/tmpyvfjboor/tmp	-k	31,55,79,103,127	--merged	/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.extendedFrags.fastq.gz	
              [spades] 
              [spades] System information:
              [spades]   SPAdes version: 3.14.1
              [spades]   Python version: 3.8.8
              [spades]   OS: Linux-6.8.0-1014-azure-x86_64-with-glibc2.10
              [spades] 
              [spades] Output dir: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades
              [spades] Mode: ONLY assembling (without read error correction)
              [spades] Debug mode is turned OFF
              [spades] 
              [spades] Dataset parameters:
              [spades]   Isolate mode
              [spades]   Reads:
              [spades]     Library number: 1, library type: paired-end
              [spades]       orientation: fr
              [spades]       left reads: ['/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_1.fastq.gz']
              [spades]       right reads: ['/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_2.fastq.gz']
              [spades]       interlaced reads: not specified
              [spades]       single reads: not specified
              [spades]       merged reads: ['/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.extendedFrags.fastq.gz']
              [spades] Assembly parameters:
              [spades]   k: [31, 55, 79, 103, 127]
              [spades]   Repeat resolution is enabled
              [spades]   Mismatch careful mode is turned OFF
              [spades]   MismatchCorrector will be SKIPPED
              [spades]   Coverage cutoff is turned OFF
              [spades] Other parameters:
              [spades]   Dir for temp files: /tmp/tmpyvfjboor/tmp
              [spades]   Threads: 1
              [spades]   Memory limit (in Gb): 4
              [spades] 
              [spades] 
              [spades] ======= SPAdes pipeline started. Log can be found here: /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/spades.log
              [spades] 
              [spades] /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_1.fastq.gz: max reads length: 301
              [spades] /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/flash.notCombined_2.fastq.gz: max reads length: 301
              [spades] Files with merged reads were ignored.
              [spades] 
              [spades] Reads length: 301
              [spades] 
              [spades] 
              [spades] ===== Before start started. 
              [spades] 
              [spades] 
              [spades] ===== Assembling started. 
              [spades] 
              [spades] 
              [spades] ===== K31 started. 
              [spades] 
              [spades] 
              [spades] == Running: /usr/local/bin/spades-core /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/K31/configs/config.info /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/K31/configs/isolate_mode.info
              [spades] 
              [spades] WARNING: Try to use logger before create one. Level=INFO. Message=Additional contigs is tmp_contigs.fasta
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  75)   Loaded config from /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/K31/configs/config.info
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  75)   Loaded config from /tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/K31/configs/isolate_mode.info
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (memory_limit.cpp          :  49)   Memory limit set to 4 Gb
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  85)   Starting SPAdes, built from N/A, git revision N/A
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  86)   Maximum k-mer length: 128
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  87)   Assembling dataset (/tmp/tmpyvfjboor/job_working_directory/000/3/working/out/spades/dataset.info) with K=31
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (main.cpp                  :  88)   Maximum # of threads to use (adjusted due to OMP capabilities): 1
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (pipeline.cpp              : 194)   SPAdes started
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (pipeline.cpp              : 201)   Starting from stage: read_conversion
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (pipeline.cpp              : 207)   Two-step RR enabled: 0
              [spades]   0:00:00.000     4M / 13M   INFO   StageManager             (stage.cpp                 : 166)   STAGE == Binary Read Conversion
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (read_converter.cpp        :  72)   Converting reads to binary format for library #0 (takes a while)
              [spades]   0:00:00.000     4M / 13M   INFO    General                 (read_converter.cpp        :  73)   Converting paired reads
              [spades]   0:00:00.082    34M / 34M   INFO    General                 (binary_converter.cpp      : 111)   4674 reads written
              [spades]   0:00:00.082    10M / 22M   INFO    General                 (read_converter.cpp        :  81)   Converting single reads
              [spades]   0:00:00.082    20M / 22M   INFO    General                 (binary_converter.cpp      : 111)   0 reads written
              [spades]   0:00:00.082    20M / 22M   INFO    General                 (read_converter.cpp        :  87)   Converting merged reads
              [spades]   0:00:00.158    22M / 27M   INFO    General                 (binary_converter.cpp      :  96)   16384 reads processed
              [spades]   0:00:00.234    31M / 38M   INFO    General                 (binary_converter.cpp      :  96)   32768 reads processed
              [spades]   0:00:00.476    40M / 50M   INFO    General                 (binary_converter.cpp      :  96)   65536 reads processed
              [spades]   0:00:00.864    40M / 52M   INFO    General                 (binary_converter.cpp      :  96)   131072 reads processed
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (binary_converter.cpp      : 111)   143166 reads written
              [spades]   0:00:01.003    40M / 52M   INFO   StageManager             (stage.cpp                 : 166)   STAGE == de Bruijn graph construction
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (construction.cpp          : 150)   Max read length 582
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (construction.cpp          : 153)   Max read length without merged 301
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (construction.cpp          : 156)   Average read length 220.751
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (stage.cpp                 : 113)   PROCEDURE == k+1-mer counting
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (kmer_index_builder.hpp    : 117)   Splitting kmer instances into 1 files using 1 threads. This might take a while.
              [spades]   0:00:01.003    40M / 52M   INFO    General                 (file_limit.hpp            :  32)   Open file limit set to 1048576
              [spades]   0:00:01.004    40M / 52M   INFO    General                 (kmer_splitters.hpp        :  89)   Memory available for splitting buffers: 1.33293 Gb
              [spades]   0:00:01.004    40M / 52M   INFO    General                 (kmer_splitters.hpp        :  97)   Using cell size of 67108864
              [spades]   0:00:05.783   684M / 684M  INFO    General                 (kmer_splitters.hpp        : 287)   Processed 305028 reads
              [spades]   0:00:05.784    44M / 500M  INFO    General                 (kmer_splitters.hpp        : 293)   Used 305028 reads
              [spades]   0:00:05.784    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 120)   Starting k-mer counting.
              [spades]   0:00:05.955    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 127)   K-mer counting done. There are 3909457 kmers in total.
              [spades]   0:00:05.955    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 133)   Merging temporary buckets.
              [spades]   0:00:05.983    44M / 500M  INFO    General                 (stage.cpp                 : 113)   PROCEDURE == Extension index construction
              [spades]   0:00:05.983    44M / 500M  INFO   K-mer Index Building     (kmer_index_builder.hpp    : 301)   Building kmer index
              [spades]   0:00:05.983    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 117)   Splitting kmer instances into 16 files using 1 threads. This might take a while.
              [spades]   0:00:05.983    44M / 500M  INFO    General                 (file_limit.hpp            :  32)   Open file limit set to 1048576
              [spades]   0:00:05.984    44M / 500M  INFO    General                 (kmer_splitters.hpp        :  89)   Memory available for splitting buffers: 1.33317 Gb
              [spades]   0:00:05.984    44M / 500M  INFO    General                 (kmer_splitters.hpp        :  97)   Using cell size of 4194304
              [spades]   0:00:07.215   684M / 684M  INFO    General                 (kmer_splitters.hpp        : 364)   Processed 3909457 kmers
              [spades]   0:00:07.215   684M / 684M  INFO    General                 (kmer_splitters.hpp        : 369)   Used 3909457 kmers.
              [spades]   0:00:07.218    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 120)   Starting k-mer counting.
              [spades]   0:00:07.406    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 127)   K-mer counting done. There are 3898384 kmers in total.
              [spades]   0:00:07.406    44M / 500M  INFO    General                 (kmer_index_builder.hpp    : 133)   Merging temporary buckets.
              [spades]   0:00:07.436    44M / 500M  INFO   K-mer Index Building     (kmer_index_builder.hpp    : 314)   Building perfect hash indices
              [spades]   0:00:07.977    10M / 500M  INFO    General                 (kmer_index_builder.hpp    : 150)   Merging final buckets.
              [spades]   0:00:08.013    10M / 500M  INFO   K-mer Index Building     (kmer_index_builder.hpp    : 336)   Index built. Total 1816056 bytes occupied (3.72679 bits per kmer).
              [spades]   0:00:08.014    14M / 500M  INFO   DeBruijnExtensionIndexBu (kmer_extension_index_build:  99)   Building k-mer extensions from k+1-mers
              [spades]   0:00:08.952    14M / 500M  INFO   DeBruijnExtensionIndexBu (kmer_extension_index_build: 103)   Building k-mer extensions from k+1-mers finished.
              [spades]   0:00:08.953    14M / 500M  INFO    General                 (stage.cpp                 : 113)   PROCEDURE == Early tip clipping
              [spades]   0:00:08.953    14M / 500M  INFO    General                 (construction.cpp          : 293)   Early tip clipper length bound set as (RL - K)
              [spades]   0:00:08.953    14M / 500M  INFO   Early tip clipping       (early_simplification.hpp  :  28)   Early tip clipping
              [spades]   0:00:09.984    15M / 500M  INFO   Early tip clipping       (early_simplification.hpp  :  63)   #tipped junctions: 6457
              [spades]   0:00:09.985    15M / 500M  INFO   Early tip clipping       (early_simplification.hpp  :  74)   Clipped tips: 6500
              [spades]   0:00:09.986    15M / 500M  INFO   Early tip clipping       (early_simplification.hpp  :  30)   352811 32-mers were removed by early tip clipper
              [spades]   0:00:09.986    15M / 500M  INFO    General                 (stage.cpp                 : 113)   PROCEDURE == Condensing graph
              [spades]   0:00:09.987    15M / 500M  INFO   UnbranchingPathExtractor (debruijn_graph_constructor: 354)   Extracting unbranching paths
              [spades]   0:00:11.299    19M / 500M  INFO   UnbranchingPathExtractor (debruijn_graph_constructor: 373)   Extracting unbranching paths finished. 33694 sequences extracted
              [spades]   0:00:11.984    20M / 500M  INFO   UnbranchingPathExtractor (debruijn_graph_constructor: 309)   Collecting perfect loops
              [spades]   0:00:12.347    20M / 500M  INFO   UnbranchingPathExtractor (debruijn_graph_constructor: 342)   Collecting perfect loops finished. 0 loops collected
              [spades]   0:00:12.375    27M / 500M  INFO    General                 (stage.cpp                 : 113)   PROCEDURE == Filling coverage indices (PHM)
              [spades]   0:00:12.375    27M / 500M  INFO   K-mer Index Building     (kmer_index_builder.hpp    : 301)   Building kmer index
              [spades]   0:00:12.375    27M / 500M  INFO   K-mer Index Building     (kmer_index_builder.hpp    : 314)   Building perfect hash indices
              [sp
              ..
              lon.fasta
              [pilon] Writing NODE_55_length_20231_cov_4.391614:1-20231 changes to pilon.changes
              [pilon] Writing updated NODE_55_length_20231_cov_4.391614_pilon to pilon.fasta
              [pilon] Writing NODE_56_length_20027_cov_4.610101:1-20027 changes to pilon.changes
              [pilon] Writing updated NODE_56_length_20027_cov_4.610101_pilon to pilon.fasta
              [pilon] Writing NODE_57_length_19230_cov_4.313040:1-19230 changes to pilon.changes
              [pilon] Writing updated NODE_57_length_19230_cov_4.313040_pilon to pilon.fasta
              [pilon] Writing NODE_58_length_19174_cov_4.235313:1-19174 changes to pilon.changes
              [pilon] Writing updated NODE_58_length_19174_cov_4.235313_pilon to pilon.fasta
              [pilon] Writing NODE_59_length_19072_cov_4.347163:1-19072 changes to pilon.changes
              [pilon] Writing updated NODE_59_length_19072_cov_4.347163_pilon to pilon.fasta
              [pilon] Writing NODE_60_length_18959_cov_4.650329:1-18959 changes to pilon.changes
              [pilon] Writing updated NODE_60_length_18959_cov_4.650329_pilon to pilon.fasta
              [pilon] Writing NODE_61_length_17610_cov_4.439799:1-17610 changes to pilon.changes
              [pilon] Writing updated NODE_61_length_17610_cov_4.439799_pilon to pilon.fasta
              [pilon] Writing NODE_62_length_16945_cov_4.137531:1-16945 changes to pilon.changes
              [pilon] Writing updated NODE_62_length_16945_cov_4.137531_pilon to pilon.fasta
              [pilon] Writing NODE_63_length_16221_cov_4.677209:1-16221 changes to pilon.changes
              [pilon] Writing updated NODE_63_length_16221_cov_4.677209_pilon to pilon.fasta
              [pilon] Writing NODE_64_length_16064_cov_4.981490:1-16064 changes to pilon.changes
              [pilon] Writing updated NODE_64_length_16064_cov_4.981490_pilon to pilon.fasta
              [pilon] Writing NODE_65_length_16026_cov_4.533178:1-16026 changes to pilon.changes
              [pilon] Writing updated NODE_65_length_16026_cov_4.533178_pilon to pilon.fasta
              [pilon] Writing NODE_66_length_15813_cov_4.281589:1-15813 changes to pilon.changes
              [pilon] Writing updated NODE_66_length_15813_cov_4.281589_pilon to pilon.fasta
              [pilon] Writing NODE_67_length_15608_cov_4.445320:1-15608 changes to pilon.changes
              [pilon] Writing updated NODE_67_length_15608_cov_4.445320_pilon to pilon.fasta
              [pilon] Writing NODE_68_length_14984_cov_4.276772:1-14984 changes to pilon.changes
              [pilon] Writing updated NODE_68_length_14984_cov_4.276772_pilon to pilon.fasta
              [pilon] Writing NODE_69_length_13797_cov_3.784931:1-13797 changes to pilon.changes
              [pilon] Writing updated NODE_69_length_13797_cov_3.784931_pilon to pilon.fasta
              [pilon] Writing NODE_70_length_13168_cov_4.700713:1-13168 changes to pilon.changes
              [pilon] Writing updated NODE_70_length_13168_cov_4.700713_pilon to pilon.fasta
              [pilon] Writing NODE_71_length_13100_cov_4.909119:1-13100 changes to pilon.changes
              [pilon] Writing updated NODE_71_length_13100_cov_4.909119_pilon to pilon.fasta
              [pilon] Writing NODE_72_length_13077_cov_4.751660:1-13077 changes to pilon.changes
              [pilon] Writing updated NODE_72_length_13077_cov_4.751660_pilon to pilon.fasta
              [pilon] Writing NODE_73_length_12807_cov_4.900552:1-12807 changes to pilon.changes
              [pilon] Writing updated NODE_73_length_12807_cov_4.900552_pilon to pilon.fasta
              [pilon] Writing NODE_74_length_12357_cov_4.946361:1-12357 changes to pilon.changes
              [pilon] Writing updated NODE_74_length_12357_cov_4.946361_pilon to pilon.fasta
              [pilon] Writing NODE_75_length_12074_cov_14.061773:1-12074 changes to pilon.changes
              [pilon] Writing updated NODE_75_length_12074_cov_14.061773_pilon to pilon.fasta
              [pilon] Writing NODE_76_length_11206_cov_4.632999:1-11206 changes to pilon.changes
              [pilon] Writing updated NODE_76_length_11206_cov_4.632999_pilon to pilon.fasta
              [pilon] Writing NODE_77_length_9928_cov_3.991327:1-9928 changes to pilon.changes
              [pilon] Writing updated NODE_77_length_9928_cov_3.991327_pilon to pilon.fasta
              [pilon] Writing NODE_78_length_9894_cov_4.743934:1-9894 changes to pilon.changes
              [pilon] Writing updated NODE_78_length_9894_cov_4.743934_pilon to pilon.fasta
              [pilon] Writing NODE_79_length_9698_cov_4.709644:1-9698 changes to pilon.changes
              [pilon] Writing updated NODE_79_length_9698_cov_4.709644_pilon to pilon.fasta
              [pilon] Writing NODE_80_length_9457_cov_4.659378:1-9457 changes to pilon.changes
              [pilon] Writing updated NODE_80_length_9457_cov_4.659378_pilon to pilon.fasta
              [pilon] Writing NODE_81_length_9295_cov_4.713351:1-9295 changes to pilon.changes
              [pilon] Writing updated NODE_81_length_9295_cov_4.713351_pilon to pilon.fasta
              [pilon] Writing NODE_82_length_8939_cov_4.710395:1-8939 changes to pilon.changes
              [pilon] Writing updated NODE_82_length_8939_cov_4.710395_pilon to pilon.fasta
              [pilon] Writing NODE_83_length_8030_cov_3.467671:1-8030 changes to pilon.changes
              [pilon] Writing updated NODE_83_length_8030_cov_3.467671_pilon to pilon.fasta
              [pilon] Writing NODE_84_length_8008_cov_4.718056:1-8008 changes to pilon.changes
              [pilon] Writing updated NODE_84_length_8008_cov_4.718056_pilon to pilon.fasta
              [pilon] Writing NODE_85_length_7740_cov_4.601734:1-7740 changes to pilon.changes
              [pilon] Writing updated NODE_85_length_7740_cov_4.601734_pilon to pilon.fasta
              [pilon] Writing NODE_86_length_6929_cov_4.236842:1-6929 changes to pilon.changes
              [pilon] Writing updated NODE_86_length_6929_cov_4.236842_pilon to pilon.fasta
              [pilon] Writing NODE_87_length_6829_cov_3.278424:1-6829 changes to pilon.changes
              [pilon] Writing updated NODE_87_length_6829_cov_3.278424_pilon to pilon.fasta
              [pilon] Writing NODE_88_length_6716_cov_3.843072:1-6716 changes to pilon.changes
              [pilon] Writing updated NODE_88_length_6716_cov_3.843072_pilon to pilon.fasta
              [pilon] Writing NODE_89_length_5969_cov_13.311195:1-5969 changes to pilon.changes
              [pilon] Writing updated NODE_89_length_5969_cov_13.311195_pilon to pilon.fasta
              [pilon] Writing NODE_90_length_5337_cov_4.258157:1-5337 changes to pilon.changes
              [pilon] Writing updated NODE_90_length_5337_cov_4.258157_pilon to pilon.fasta
              [pilon] Writing NODE_91_length_3610_cov_4.532587:1-3610 changes to pilon.changes
              [pilon] Writing updated NODE_91_length_3610_cov_4.532587_pilon to pilon.fasta
              [pilon] Writing NODE_92_length_3558_cov_3.047508:1-3558 changes to pilon.changes
              [pilon] Writing updated NODE_92_length_3558_cov_3.047508_pilon to pilon.fasta
              [pilon] Writing NODE_93_length_3276_cov_9.182280:1-3276 changes to pilon.changes
              [pilon] Writing updated NODE_93_length_3276_cov_9.182280_pilon to pilon.fasta
              [pilon] Writing NODE_94_length_3240_cov_4.733055:1-3240 changes to pilon.changes
              [pilon] Writing updated NODE_94_length_3240_cov_4.733055_pilon to pilon.fasta
              [pilon] Writing NODE_95_length_2789_cov_4.926371:1-2789 changes to pilon.changes
              [pilon] Writing updated NODE_95_length_2789_cov_4.926371_pilon to pilon.fasta
              [pilon] Writing NODE_96_length_2751_cov_3.338796:1-2751 changes to pilon.changes
              [pilon] Writing updated NODE_96_length_2751_cov_3.338796_pilon to pilon.fasta
              [pilon] Writing NODE_97_length_2685_cov_3.486317:1-2685 changes to pilon.changes
              [pilon] Writing updated NODE_97_length_2685_cov_3.486317_pilon to pilon.fasta
              [pilon] Writing NODE_98_length_2452_cov_4.710538:1-2452 changes to pilon.changes
              [pilon] Writing updated NODE_98_length_2452_cov_4.710538_pilon to pilon.fasta
              [pilon] Writing NODE_99_length_2401_cov_4.664908:1-2401 changes to pilon.changes
              [pilon] Writing updated NODE_99_length_2401_cov_4.664908_pilon to pilon.fasta
              [pilon] Writing NODE_100_length_2342_cov_4.800903:1-2342 changes to pilon.changes
              [pilon] Writing updated NODE_100_length_2342_cov_4.800903_pilon to pilon.fasta
              [pilon] Writing NODE_101_length_2082_cov_4.214834:1-2082 changes to pilon.changes
              [pilon] Writing updated NODE_101_length_2082_cov_4.214834_pilon to pilon.fasta
              [pilon] Writing NODE_102_length_1817_cov_16.736095:1-1817 changes to pilon.changes
              [pilon] Writing updated NODE_102_length_1817_cov_16.736095_pilon to pilon.fasta
              [pilon] Writing NODE_103_length_1775_cov_8.408374:1-1775 changes to pilon.changes
              [pilon] Writing updated NODE_103_length_1775_cov_8.408374_pilon to pilon.fasta
              [pilon] Writing NODE_104_length_1642_cov_17.825743:1-1642 changes to pilon.changes
              [pilon] Writing updated NODE_104_length_1642_cov_17.825743_pilon to pilon.fasta
              [pilon] Writing NODE_105_length_1578_cov_17.636802:1-1578 changes to pilon.changes
              [pilon] Writing updated NODE_105_length_1578_cov_17.636802_pilon to pilon.fasta
              [pilon] Writing NODE_106_length_1526_cov_46.761973:1-1526 changes to pilon.changes
              [pilon] Writing updated NODE_106_length_1526_cov_46.761973_pilon to pilon.fasta
              [pilon] Writing NODE_107_length_1515_cov_15.089337:1-1515 changes to pilon.changes
              [pilon] Writing updated NODE_107_length_1515_cov_15.089337_pilon to pilon.fasta
              [pilon] Writing NODE_108_length_1471_cov_3.444940:1-1471 changes to pilon.changes
              [pilon] Writing updated NODE_108_length_1471_cov_3.444940_pilon to pilon.fasta
              [pilon] Writing NODE_109_length_1418_cov_5.120837:1-1418 changes to pilon.changes
              [pilon] Writing updated NODE_109_length_1418_cov_5.120837_pilon to pilon.fasta
              [pilon] Writing NODE_110_length_1300_cov_4.227621:1-1300 changes to pilon.changes
              [pilon] Writing updated NODE_110_length_1300_cov_4.227621_pilon to pilon.fasta
              [pilon] Writing NODE_111_length_864_cov_4.430122:1-864 changes to pilon.changes
              [pilon] Writing updated NODE_111_length_864_cov_4.430122_pilon to pilon.fasta
              [pilon] Writing NODE_112_length_734_cov_2.586491:1-734 changes to pilon.changes
              [pilon] Writing updated NODE_112_length_734_cov_2.586491_pilon to pilon.fasta
              [pilon] Writing NODE_113_length_652_cov_68.649524:1-652 changes to pilon.changes
              [pilon] Writing updated NODE_113_length_652_cov_68.649524_pilon to pilon.fasta
              [pilon] Writing NODE_114_length_649_cov_9.329502:1-649 changes to pilon.changes
              [pilon] Writing updated NODE_114_length_649_cov_9.329502_pilon to pilon.fasta
              [pilon] Writing NODE_115_length_534_cov_7.778870:1-534 changes to pilon.changes
              [pilon] Writing updated NODE_115_length_534_cov_7.778870_pilon to pilon.fasta
              [pilon] Writing NODE_116_length_452_cov_8.990769:1-452 changes to pilon.changes
              [pilon] Writing updated NODE_116_length_452_cov_8.990769_pilon to pilon.fasta
              [pilon] Writing NODE_117_length_445_cov_2.918239:1-445 changes to pilon.changes
              [pilon] Writing updated NODE_117_length_445_cov_2.918239_pilon to pilon.fasta
              [pilon] Writing NODE_118_length_442_cov_7.025397:1-442 changes to pilon.changes
              [pilon] Writing updated NODE_118_length_442_cov_7.025397_pilon to pilon.fasta
              [pilon] Writing NODE_119_length_412_cov_7.610526:1-412 changes to pilon.changes
              [pilon] Writing updated NODE_119_length_412_cov_7.610526_pilon to pilon.fasta
              [pilon] Writing NODE_120_length_412_cov_5.796491:1-412 changes to pilon.changes
              [pilon] Writing updated NODE_120_length_412_cov_5.796491_pilon to pilon.fasta
              [pilon] Writing NODE_121_length_378_cov_5.812749:1-378 changes to pilon.changes
              [pilon] Writing updated NODE_121_length_378_cov_5.812749_pilon to pilon.fasta
              [pilon] Writing NODE_122_length_372_cov_9.706122:1-372 changes to pilon.changes
              [pilon] Writing updated NODE_122_length_372_cov_9.706122_pilon to pilon.fasta
              [pilon] Writing NODE_123_length_357_cov_4.413043:1-357 changes to pilon.changes
              [pilon] Writing updated NODE_123_length_357_cov_4.413043_pilon to pilon.fasta
              [pilon] Writing NODE_124_length_351_cov_6.986607:1-351 changes to pilon.changes
              [pilon] Writing updated NODE_124_length_351_cov_6.986607_pilon to pilon.fasta
              [pilon] Writing NODE_125_length_348_cov_24.090498:1-348 changes to pilon.changes
              [pilon] Writing updated NODE_125_length_348_cov_24.090498_pilon to pilon.fasta
              [pilon] Writing NODE_126_length_338_cov_4.303318:1-338 changes to pilon.changes
              [pilon] Writing updated NODE_126_length_338_cov_4.303318_pilon to pilon.fasta
              [pilon] Writing NODE_127_length_332_cov_33.619512:1-332 changes to pilon.changes
              [pilon] Writing updated NODE_127_length_332_cov_33.619512_pilon to pilon.fasta
              [pilon] Writing NODE_128_length_323_cov_5.571429:1-323 changes to pilon.changes
              [pilon] Writing updated NODE_128_length_323_cov_5.571429_pilon to pilon.fasta
              [pilon] Writing NODE_129_length_322_cov_5.158974:1-322 changes to pilon.changes
              [pilon] Writing updated NODE_129_length_322_cov_5.158974_pilon to pilon.fasta
              [pilon] Writing NODE_130_length_319_cov_12.744792:1-319 changes to pilon.changes
              [pilon] Writing updated NODE_130_length_319_cov_12.744792_pilon to pilon.fasta
              [pilon] Writing NODE_131_length_300_cov_54.994220:1-300 changes to pilon.changes
              [pilon] Writing updated NODE_131_length_300_cov_54.994220_pilon to pilon.fasta
              [pilon] Writing NODE_132_length_267_cov_5.121429:1-267 changes to pilon.changes
              [pilon] Writing updated NODE_132_length_267_cov_5.121429_pilon to pilon.fasta
              [pilon] Writing NODE_133_length_255_cov_20.773438:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_133_length_255_cov_20.773438_pilon to pilon.fasta
              [pilon] Writing NODE_134_length_255_cov_12.320312:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_134_length_255_cov_12.320312_pilon to pilon.fasta
              [pilon] Writing NODE_135_length_255_cov_10.453125:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_135_length_255_cov_10.453125_pilon to pilon.fasta
              [pilon] Writing NODE_136_length_255_cov_7.695312:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_136_length_255_cov_7.695312_pilon to pilon.fasta
              [pilon] Writing NODE_137_length_255_cov_7.585938:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_137_length_255_cov_7.585938_pilon to pilon.fasta
              [pilon] Writing NODE_138_length_255_cov_6.406250:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_138_length_255_cov_6.406250_pilon to pilon.fasta
              [pilon] Writing NODE_139_length_255_cov_5.460938:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_139_length_255_cov_5.460938_pilon to pilon.fasta
              [pilon] Writing NODE_140_length_255_cov_4.812500:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_140_length_255_cov_4.812500_pilon to pilon.fasta
              [pilon] Writing NODE_141_length_255_cov_2.320312:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_141_length_255_cov_2.320312_pilon to pilon.fasta
              [pilon] Writing NODE_142_length_255_cov_2.195312:1-255 changes to pilon.changes
              [pilon] Writing updated NODE_142_length_255_cov_2.195312_pilon to pilon.fasta
              [pilon] Writing NODE_143_length_254_cov_9.921260:1-254 changes to pilon.changes
              [pilon] Writing updated NODE_143_length_254_cov_9.921260_pilon to pilon.fasta
              [pilon] Writing NODE_144_length_253_cov_7.809524:1-253 changes to pilon.changes
              [pilon] Writing updated NODE_144_length_253_cov_7.809524_pilon to pilon.fasta
              [pilon] Writing NODE_145_length_252_cov_3.672000:1-252 changes to pilon.changes
              [pilon] Writing updated NODE_145_length_252_cov_3.672000_pilon to pilon.fasta
              [pilon] Writing NODE_146_length_250_cov_10.585366:1-250 changes to pilon.changes
              [pilon] Writing updated NODE_146_length_250_cov_10.585366_pilon to pilon.fasta
              [pilon] Writing NODE_147_length_249_cov_16.508197:1-249 changes to pilon.changes
              [pilon] Writing updated NODE_147_length_249_cov_16.508197_pilon to pilon.fasta
              [pilon] Writing NODE_148_length_246_cov_4.647059:1-246 changes to pilon.changes
              [pilon] Writing updated NODE_148_length_246_cov_4.647059_pilon to pilon.fasta
              [pilon] Writing NODE_149_length_231_cov_16.836538:1-231 changes to pilon.changes
              [pilon] Writing updated NODE_149_length_231_cov_16.836538_pilon to pilon.fasta
              [pilon] Writing NODE_150_length_221_cov_3.361702:1-221 changes to pilon.changes
              [pilon] Writing updated NODE_150_length_221_cov_3.361702_pilon to pilon.fasta
              [pilon] Writing NODE_151_length_187_cov_11.066667:1-187 changes to pilon.changes
              [pilon] Writing updated NODE_151_length_187_cov_11.066667_pilon to pilon.fasta
              [pilon] Writing NODE_152_length_151_cov_19.083333:1-151 changes to pilon.changes
              [pilon] Writing updated NODE_152_length_151_cov_19.083333_pilon to pilon.fasta
              [pilon] Writing NODE_153_length_135_cov_13.000000:1-135 changes to pilon.changes
              [pilon] Writing updated NODE_153_length_135_cov_13.000000_pilon to pilon.fasta
              [pilon] Writing NODE_154_length_128_cov_298.000000:1-128 changes to pilon.changes
              [pilon] Writing updated NODE_154_length_128_cov_298.000000_pilon to pilon.fasta
              [pilon] Writing NODE_155_length_128_cov_39.000000:1-128 changes to pilon.changes
              [pilon] Writing updated NODE_155_length_128_cov_39.000000_pilon to pilon.fasta
              [pilon] Writing NODE_156_length_128_cov_8.000000:1-128 changes to pilon.changes
              [pilon] Writing updated NODE_156_length_128_cov_8.000000_pilon to pilon.fasta
              [pilon] Mean frags coverage: 17
              [pilon] Mean total coverage: 17
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "fastqsanger.gz"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              adv {"depth": "100", "gsize": "", "keep_files": {"__current_case__": 1, "keepfiles": true, "nocorr": "yes_correction"}, "kmers": "", "mincov": "2", "minlen": "0", "namefmt": "contig%05d", "opts": ""}
              assembler "spades"
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              library {"R1": {"values": [{"id": 1, "src": "hda"}]}, "R2": {"values": [{"id": 2, "src": "hda"}]}, "__current_case__": 0, "lib_type": "paired"}
              log true
              trim false
      • Step 4: quast_quality:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • echo shovill_contigs_fasta &&   ln -s '/tmp/tmpyvfjboor/files/4/4/9/dataset_4492e6fa-b9c2-4092-9f54-074186a55740.dat' 'pe1-fastp_trimmed_R1.fastqsanger.gz.fastqsanger.gz' && ln -s '/tmp/tmpyvfjboor/files/9/4/2/dataset_942dd72b-8156-49c6-9614-187e47876ae6.dat' 'pe2-fastp_trimmed_R2.fastqsanger.gz.fastqsanger.gz' &&  quast  --pe1 'pe1-fastp_trimmed_R1.fastqsanger.gz.fastqsanger.gz' --pe2 'pe2-fastp_trimmed_R2.fastqsanger.gz.fastqsanger.gz' --labels 'shovill_contigs_fasta' -o 'outputdir'   --min-identity 95.0 --min-contig 500      --conserved-genes-finding  --min-alignment 65 --ambiguity-usage 'one' --ambiguity-score 0.99   --local-mis-size 200   --contig-thresholds '0,1000'  --extensive-mis-size 1000 --scaffold-gap-max-size 1000 --unaligned-part-size 500   --x-for-Nx 90  '/tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat' --threads ${GALAXY_SLOTS:-1}  && mkdir -p '/tmp/tmpyvfjboor/job_working_directory/000/4/outputs/dataset_452ce665-5f8b-4b15-9082-4ab92a50fc94_files' && cp outputdir/*.html '/tmp/tmpyvfjboor/job_working_directory/000/4/outputs/dataset_452ce665-5f8b-4b15-9082-4ab92a50fc94_files' && cp -R outputdir/icarus_viewers '/tmp/tmpyvfjboor/job_working_directory/000/4/outputs/dataset_452ce665-5f8b-4b15-9082-4ab92a50fc94_files'

            Exit Code:

            • 0

            Standard Output:

            • shovill_contigs_fasta
              /usr/local/bin/quast --pe1 pe1-fastp_trimmed_R1.fastqsanger.gz.fastqsanger.gz --pe2 pe2-fastp_trimmed_R2.fastqsanger.gz.fastqsanger.gz --labels shovill_contigs_fasta -o outputdir --min-identity 95.0 --min-contig 500 --conserved-genes-finding --min-alignment 65 --ambiguity-usage one --ambiguity-score 0.99 --local-mis-size 200 --contig-thresholds 0,1000 --extensive-mis-size 1000 --scaffold-gap-max-size 1000 --unaligned-part-size 500 --x-for-Nx 90 /tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat --threads 1
              
              Version: 5.2.0
              
              System information:
                OS: Linux-6.8.0-1014-azure-x86_64-with-glibc2.28 (linux_64)
                Python version: 3.9.13
                CPUs number: 4
              
              Started: 2024-09-23 19:38:38
              
              Logging to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/quast.log
              WARNING: --ambiguity-usage was set to 'all' because not default --ambiguity-score was specified
              
              CWD: /tmp/tmpyvfjboor/job_working_directory/000/4/working
              Main parameters: 
                MODE: default, threads: 1, min contig length: 500, min alignment length: 65, min alignment IDY: 95.0, \
                ambiguity: all, min local misassembly length: 200, min extensive misassembly length: 1000
              
              Contigs:
                Pre-processing...
                /tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat ==> shovill_contigs_fasta
              
              2024-09-23 19:38:39
              Running Reads analyzer...
              NOTICE: Permission denied accessing /usr/local/lib/python3.9/site-packages/quast_libs/gridss. GRIDSS will be downloaded to home directory /tmp/tmpyvfjboor/job_working_directory/000/4/home/.quast
              Downloading gridss (file: gridss-1.4.1.jar)...
               0.0% of 38935087 bytes
               1.0% of 38935087 bytes
               2.0% of 38935087 bytes
               3.0% of 38935087 bytes
               4.0% of 38935087 bytes
               5.0% of 38935087 bytes
               6.0% of 38935087 bytes
               7.0% of 38935087 bytes
               8.0% of 38935087 bytes
               9.0% of 38935087 bytes
               10.0% of 38935087 bytes
               11.0% of 38935087 bytes
               12.0% of 38935087 bytes
               13.0% of 38935087 bytes
               14.0% of 38935087 bytes
               15.0% of 38935087 bytes
               16.0% of 38935087 bytes
               17.0% of 38935087 bytes
               18.0% of 38935087 bytes
               19.0% of 38935087 bytes
               20.0% of 38935087 bytes
               21.0% of 38935087 bytes
               22.0% of 38935087 bytes
               23.0% of 38935087 bytes
               24.0% of 38935087 bytes
               25.0% of 38935087 bytes
               26.0% of 38935087 bytes
               27.0% of 38935087 bytes
               28.0% of 38935087 bytes
               29.0% of 38935087 bytes
               30.0% of 38935087 bytes
               31.0% of 38935087 bytes
               32.0% of 38935087 bytes
               33.0% of 38935087 bytes
               34.0% of 38935087 bytes
               35.0% of 38935087 bytes
               36.0% of 38935087 bytes
               37.0% of 38935087 bytes
               38.0% of 38935087 bytes
               39.0% of 38935087 bytes
               40.0% of 38935087 bytes
               41.0% of 38935087 bytes
               42.0% of 38935087 bytes
               43.0% of 38935087 bytes
               44.0% of 38935087 bytes
               45.0% of 38935087 bytes
               46.0% of 38935087 bytes
               47.0% of 38935087 bytes
               48.0% of 38935087 bytes
               49.0% of 38935087 bytes
               50.0% of 38935087 bytes
               51.0% of 38935087 bytes
               52.0% of 38935087 bytes
               53.0% of 38935087 bytes
               54.0% of 38935087 bytes
               55.0% of 38935087 bytes
               56.0% of 38935087 bytes
               57.0% of 38935087 bytes
               58.0% of 38935087 bytes
               59.0% of 38935087 bytes
               60.0% of 38935087 bytes
               61.0% of 38935087 bytes
               62.0% of 38935087 bytes
               63.0% of 38935087 bytes
               64.0% of 38935087 bytes
               65.0% of 38935087 bytes
               66.0% of 38935087 bytes
               67.0% of 38935087 bytes
               68.0% of 38935087 bytes
               69.0% of 38935087 bytes
               70.0% of 38935087 bytes
               71.0% of 38935087 bytes
               72.0% of 38935087 bytes
               73.0% of 38935087 bytes
               74.0% of 38935087 bytes
               75.0% of 38935087 bytes
               76.0% of 38935087 bytes
               77.0% of 38935087 bytes
               78.0% of 38935087 bytes
               79.0% of 38935087 bytes
               80.0% of 38935087 bytes
               81.0% of 38935087 bytes
               82.0% of 38935087 bytes
               83.0% of 38935087 bytes
               84.0% of 38935087 bytes
               85.0% of 38935087 bytes
               86.0% of 38935087 bytes
               87.0% of 38935087 bytes
               88.0% of 38935087 bytes
               88.0% of 38935087 bytes
               89.0% of 38935087 bytes
               90.0% of 38935087 bytes
               91.0% of 38935087 bytes
               92.0% of 38935087 bytes
               93.0% of 38935087 bytes
               94.0% of 38935087 bytes
               95.0% of 38935087 bytes
               96.0% of 38935087 bytes
               97.0% of 38935087 bytes
               98.0% of 38935087 bytes
               99.0% of 38935087 bytes
              gridss successfully downloaded!
              
              NOTICE: Improper read names in /tmp/tmpyvfjboor/job_working_directory/000/4/working/pe1-fastp_trimmed_R1.fastqsanger.gz.fastqsanger.gz (forward reads)! Names should end with /1 (for forward reads) or /2 (for reverse reads) but @M07044:90:000000000-JRJWP:1:1105:10167:16023 was found!
              QUAST will attempt to fix read names.
              
              NOTICE: Improper read names in /tmp/tmpyvfjboor/job_working_directory/000/4/working/pe2-fastp_trimmed_R2.fastqsanger.gz.fastqsanger.gz (reverse reads)! Names should end with /1 (for forward reads) or /2 (for reverse reads) but @M07044:90:000000000-JRJWP:1:1105:10167:16023 was found!
              QUAST will attempt to fix read names.
                Logging to files /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/reads_stats/reads_stats.log and /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/reads_stats/reads_stats.err...
                Pre-processing reads...
                Running BWA...
                Done.
                Sorting SAM-file...
                Analysis is finished.
                Creating total report...
                  saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/reads_stats/reads_report.txt, reads_report.tsv, and reads_report.tex
              Done.
              
              2024-09-23 19:39:34
              Running Basic statistics processor...
                Contig files: 
                  shovill_contigs_fasta
                Calculating N50 and L50...
                  shovill_contigs_fasta, N50 = 43640, L50 = 23, auN = 50792.4, Total length = 3016753, GC % = 37.31, # N's per 100 kbp =  0.00
                Drawing Nx plot...
                  saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/basic_stats/Nx_plot.pdf
                Drawing cumulative plot...
                  saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/basic_stats/cumulative_plot.pdf
                Drawing GC content plot...
                  saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/basic_stats/GC_content_plot.pdf
                Drawing shovill_contigs_fasta GC content plot...
                  saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/basic_stats/shovill_contigs_fasta_GC_content_plot.pdf
              Done.
              
              NOTICE: Genes are not predicted by default. Use --gene-finding or --glimmer option to enable it.
              
              2024-09-23 19:39:35
              Running BUSCO...
              NOTICE: Permission denied accessing /usr/local/lib/python3.9/site-packages/quast_libs/augustus3.2.3. augustus will be downloaded to home directory /tmp/tmpyvfjboor/job_working_directory/000/4/home/.quast
                Downloading third-party tools...
              Downloading augustus (file: augustus.tar.gz)...
               0.0% of 138558039 bytes
               1.0% of 138558039 bytes
               2.0% of 138558039 bytes
               3.0% of 138558039 bytes
               4.0% of 138558039 bytes
               5.0% of 138558039 bytes
               6.0% of 138558039 bytes
               7.0% of 138558039 bytes
               8.0% of 138558039 bytes
               9.0% of 138558039 bytes
               10.0% of 138558039 bytes
               11.0% of 138558039 bytes
               12.0% of 138558039 bytes
               13.0% of 138558039 bytes
               14.0% of 138558039 bytes
               15.0% of 138558039 bytes
               16.0% of 138558039 bytes
               17.0% of 138558039 bytes
               18.0% of 138558039 bytes
               19.0% of 138558039 bytes
               20.0% of 138558039 bytes
               21.0% of 138558039 bytes
               22.0% of 138558039 bytes
               23.0% of 138558039 bytes
               24.0% of 138558039 bytes
               25.0% of 138558039 bytes
               26.0% of 138558039 bytes
               27.0% of 138558039 bytes
               28.0% of 138558039 bytes
               29.0% of 138558039 bytes
               30.0% of 138558039 bytes
               31.0% of 138558039 bytes
               32.0% of 138558039 bytes
               33.0% of 138558039 bytes
               34.0% of 138558039 bytes
               35.0% of 138558039 bytes
               36.0% of 138558039 bytes
               37.0% of 138558039 bytes
               38.0% of 138558039 bytes
               39.0% of 138558039 bytes
               40.0% of 138558039 bytes
               41.0% of 138558039 bytes
               42.0% of 138558039 bytes
               43.0% of 138558039 bytes
               44.0% of 138558039 bytes
               45.0% of 138558039 bytes
               46.0% of 138558039 bytes
               47.0% of 138558039 bytes
               48.0% of 138558039 bytes
               49.0% of 138558039 bytes
               50.0% of 138558039 bytes
               51.0% of 138558039 bytes
               52.0% of 138558039 bytes
               53.0% of 138558039 bytes
               54.0% of 138558039 bytes
               55.0% of 138558039 bytes
               56.0% of 138558039 bytes
               57.0% of 138558039 bytes
               58.0% of 138558039 bytes
               59.0% of 138558039 bytes
               60.0% of 138558039 bytes
               61.0% of 138558039 bytes
               62.0% of 138558039 bytes
               63.0% of 138558039 bytes
               64.0% of 138558039 bytes
               65.0% of 138558039 bytes
               66.0% of 138558039 bytes
               67.0% of 138558039 bytes
               68.0% of 138558039 bytes
               69.0% of 138558039 bytes
               70.0% of 138558039 bytes
               71.0% of 138558039 bytes
               72.0% of 138558039 bytes
               73.0% of 138558039 bytes
               74.0% of 138558039 bytes
               75.0% of 138558039 bytes
               76.0% of 138558039 bytes
               77.0% of 138558039 bytes
               78.0% of 138558039 bytes
               79.0% of 138558039 bytes
               80.0% of 138558039 bytes
               81.0% of 138558039 bytes
               82.0% of 138558039 bytes
               83.0% of 138558039 bytes
               84.0% of 138558039 bytes
               85.0% of 138558039 bytes
               86.0% of 138558039 bytes
               87.0% of 138558039 bytes
               88.0% of 138558039 bytes
               89.0% of 138558039 bytes
               90.0% of 138558039 bytes
               91.0% of 138558039 bytes
               92.0% of 138558039 bytes
               93.0% of 138558039 bytes
               94.0% of 138558039 bytes
               95.0% of 138558039 bytes
               96.0% of 138558039 bytes
               97.0% of 138558039 bytes
               98.0% of 138558039 bytes
               99.0% of 138558039 bytes
              augustus successfully downloaded!
                Done
              NOTICE: Permission denied accessing /usr/local/lib/python3.9/site-packages/quast_libs/busco. Busco databases will be downloaded to home directory /tmp/tmpyvfjboor/job_working_directory/000/4/home/.quast
                Downloading BUSCO database...
              Downloading bacteria database (file: bacteria.tar.gz)...
              
              ERROR! Failed downloading bacteria database (url: https://busco-archive.ezlab.org/v3/datasets/bacteria_odb9.tar.gz), QUAST functionality will be limited! Exception caught: HTTP Error 404: Not Found
              You can try to download the file manually, place it in /tmp/tmpyvfjboor/job_working_directory/000/4/home/.quast/busco/bacteria.tar.gz and restart QUAST
              WARNING: Failed to download bacteria database from https://busco-archive.ezlab.org/v3/datasets/bacteria_odb9.tar.gz and unpack it into /tmp/tmpyvfjboor/job_working_directory/000/4/home/.quast/busco
              Failed finding conservative genes.
              
              2024-09-23 19:39:45
              Creating large visual summaries...
              This may take a while: press Ctrl-C to skip this step..
                1 of 2: Creating PDF with all tables and plots...
                2 of 2: Creating Icarus viewers...
              Done
              
              2024-09-23 19:39:46
              RESULTS:
                Text versions of total report are saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/report.txt, report.tsv, and report.tex
                Text versions of transposed total report are saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/transposed_report.txt, transposed_report.tsv, and transposed_report.tex
                HTML version (interactive tables and plots) is saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/report.html
                PDF version (tables and plots) is saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/report.pdf
                Icarus (contig browser) is saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/icarus.html
                Log is saved to /tmp/tmpyvfjboor/job_working_directory/000/4/working/outputdir/quast.log
              
              Finished: 2024-09-23 19:39:46
              Elapsed time: 0:01:08.363744
              NOTICEs: 6; WARNINGs: 2; non-fatal ERRORs: 1
              
              Thank you for using QUAST!
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              advanced {"contig_thresholds": "0,1000", "extensive_mis_size": "1000", "fragmented_max_indent": null, "report_all_metrics": false, "scaffold_gap_max_size": "1000", "skip_unaligned_mis_contigs": true, "strict_NA": false, "unaligned_part_size": "500", "x_for_Nx": "90"}
              alignments {"ambiguity_score": "0.99", "ambiguity_usage": "one", "fragmented": false, "local_mis_size": "200", "min_alignment": "65", "upper_bound_assembly": false, "upper_bound_min_con": null, "use_all_alignments": false}
              assembly {"__current_case__": 0, "min_identity": "95.0", "orga_type": "", "ref": {"__current_case__": 1, "est_ref_size": null, "use_ref": "false"}, "type": "genome"}
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              genes {"conserved_genes_finding": true, "gene_finding": {"__current_case__": 0, "tool": "none"}, "rna_finding": false}
              large false
              min_contig "500"
              mode {"__current_case__": 0, "in": {"__current_case__": 1, "custom": "false", "inputs": {"values": [{"id": 4, "src": "hda"}]}}, "mode": "individual", "reads": {"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "hda"}]}, "input_2": {"values": [{"id": 2, "src": "hda"}]}, "reads_option": "paired"}}
              output_files ["html", "pdf", "tabular", "log", "summary", "krona"]
              split_scaffolds false
      • Step 5: refseqmasher_genome:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s "/tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat" "shovill_contigs_fasta.fasta" &&  refseq_masher -vv matches --output refseq_masher-matches.tab --output-type tab --top-n-results 3 --min-kmer-threshold 8 -T "${TMPDIR:-/tmp}" "shovill_contigs_fasta.fasta"

            Exit Code:

            • 0

            Standard Error:

            • 2024-09-23 19:38:28,727 INFO: Collected 1 FASTA inputs and 0 read sets [in /usr/local/lib/python3.9/site-packages/refseq_masher/utils.py:185]
              2024-09-23 19:38:28,728 INFO: Creating Mash sketch file for /tmp/tmpyvfjboor/job_working_directory/000/5/working/shovill_contigs_fasta.fasta [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/sketch.py:24]
              2024-09-23 19:38:28,956 INFO: Created Mash sketch file at "/tmp/tmpyvfjboor/tmp/shovill_contigs_fasta.msh" [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/sketch.py:40]
              2024-09-23 19:38:30,100 INFO: Ran Mash dist successfully (output length=10122069). Parsing Mash dist output [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/dist.py:64]
              2024-09-23 19:38:30,573 INFO: Parsed Mash dist output into Pandas DataFrame with 54924 rows [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/dist.py:67]
              2024-09-23 19:38:30,573 INFO: Deleting temporary sketch file "/tmp/tmpyvfjboor/tmp/shovill_contigs_fasta.msh" [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/dist.py:72]
              2024-09-23 19:38:30,573 INFO: Sketch file "/tmp/tmpyvfjboor/tmp/shovill_contigs_fasta.msh" deleted! [in /usr/local/lib/python3.9/site-packages/refseq_masher/mash/dist.py:74]
              2024-09-23 19:38:30,574 INFO: Ran Mash dist on all input. Merging NCBI taxonomic information into results output. [in /usr/local/lib/python3.9/site-packages/refseq_masher/cli.py:94]
              2024-09-23 19:38:30,582 INFO: Fetching all taxonomy info for 3 unique NCBI Taxonomy UIDs [in /usr/local/lib/python3.9/site-packages/refseq_masher/taxonomy.py:35]
              2024-09-23 19:38:30,584 INFO: Dropping columns with all NA values (ncol=32) [in /usr/local/lib/python3.9/site-packages/refseq_masher/taxonomy.py:38]
              2024-09-23 19:38:30,587 INFO: Columns with all NA values dropped (ncol=10) [in /usr/local/lib/python3.9/site-packages/refseq_masher/taxonomy.py:40]
              2024-09-23 19:38:30,587 INFO: Merging Mash results with relevant taxonomic information [in /usr/local/lib/python3.9/site-packages/refseq_masher/taxonomy.py:41]
              2024-09-23 19:38:30,590 INFO: Merged Mash results with taxonomy info [in /usr/local/lib/python3.9/site-packages/refseq_masher/taxonomy.py:43]
              2024-09-23 19:38:30,590 INFO: Merged taxonomic info into results output [in /usr/local/lib/python3.9/site-packages/refseq_masher/cli.py:96]
              2024-09-23 19:38:30,590 INFO: Reordering output columns [in /usr/local/lib/python3.9/site-packages/refseq_masher/cli.py:97]
              2024-09-23 19:38:30,593 INFO: Wrote output to "refseq_masher-matches.tab" [in /usr/local/lib/python3.9/site-packages/refseq_masher/writers.py:20]
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "fasta"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              adv {"min_kmer_threshold": "8", "output_type": "tab", "verbosity": "-vv"}
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              input {"__current_case__": 0, "fasta": {"values": [{"id": 4, "src": "hda"}]}, "type": "fasta"}
              top_n_results "3"
      • Step 6: bandage_contig_graph_stats:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpyvfjboor/files/d/6/f/dataset_d6f87994-3dd9-415d-9d12-c02232e4a389.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage info input.gfa  | sed 's/:\s\+/:\t/g' > out.tab

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              tsv false
      • Step 7: bandage_contig_graph_plot:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpyvfjboor/files/d/6/f/dataset_d6f87994-3dd9-415d-9d12-c02232e4a389.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.svg' --height '1000' --width '1000'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              fontsize None
              height "1000"
              lengths false
              names false
              nodewidth None
              output_format "svg"
              width "1000"
      • Step 8: ToolDistillator:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir "tooldistillator_folder" &&  tooldistillator shovill --hid '4' '/tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat' --analysis_software_version '1.1.0' --reference_database_version '' --contig_graph_path '/tmp/tmpyvfjboor/files/d/6/f/dataset_d6f87994-3dd9-415d-9d12-c02232e4a389.dat' --contig_graph_hid '5' --bam_file_path '/tmp/tmpyvfjboor/files/0/3/6/dataset_0367631f-4532-4e4e-8077-0ce8eb01a46a.dat' --bam_file_hid '6' -o 'tooldistillator_folder/shovill_0_output.json' | tee 'XXXX' && tooldistillator quast --hid '7' '/tmp/tmpyvfjboor/files/8/8/5/dataset_885f74a0-ac32-4c2f-979f-62fd8cbe5dee.dat' --analysis_software_version '5.2.0' --reference_database_version '' --quast_html_path '/tmp/tmpyvfjboor/files/4/5/2/dataset_452ce665-5f8b-4b15-9082-4ab92a50fc94.dat' --quast_html_hid '8' -o 'tooldistillator_folder/quast_1_output.json' | tee 'XXXX' && tooldistillator refseqmasher --hid '11' '/tmp/tmpyvfjboor/files/0/1/6/dataset_0166cdbe-0b50-4b33-a863-e94bdab0045e.dat' --analysis_software_version '0.1.2' --reference_database_version '' -o 'tooldistillator_folder/refseqmasher_2_output.json' | tee 'XXXX' && tooldistillator bandage --hid '12' '/tmp/tmpyvfjboor/files/9/9/a/dataset_99a1b5dd-fbde-4c63-8eaa-43b93116da8f.dat' --analysis_software_version '2022.09' --reference_database_version '' --bandage_plot_path '/tmp/tmpyvfjboor/files/3/d/5/dataset_3d511a01-2614-42aa-b356-a237953c120e.dat' --bandage_plot_hid '13' -o 'tooldistillator_folder/bandage_3_output.json' | tee 'XXXX'

            Exit Code:

            • 0

            Standard Error:

            • 09/23/2024 07:40:04 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/c/1/d/dataset_c1dc1357-6c31-4ca4-a3fd-5f09b1c25d91.dat
              09/23/2024 07:40:04 PM: interfaces.py: Extraction of: contig_graph_path
              09/23/2024 07:40:04 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/d/6/f/dataset_d6f87994-3dd9-415d-9d12-c02232e4a389.dat
              09/23/2024 07:40:04 PM: interfaces.py: Extraction of: bam_file_path
              09/23/2024 07:40:04 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/0/3/6/dataset_0367631f-4532-4e4e-8077-0ce8eb01a46a.dat
              09/23/2024 07:40:06 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/8/8/5/dataset_885f74a0-ac32-4c2f-979f-62fd8cbe5dee.dat
              09/23/2024 07:40:06 PM: interfaces.py: Extraction of: quast_html_path
              09/23/2024 07:40:06 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/4/5/2/dataset_452ce665-5f8b-4b15-9082-4ab92a50fc94.dat
              09/23/2024 07:40:08 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/0/1/6/dataset_0166cdbe-0b50-4b33-a863-e94bdab0045e.dat
              09/23/2024 07:40:10 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/9/9/a/dataset_99a1b5dd-fbde-4c63-8eaa-43b93116da8f.dat
              09/23/2024 07:40:10 PM: interfaces.py: Extraction of: bandage_plot_path
              09/23/2024 07:40:10 PM: interfaces.py: Treatment of /tmp/tmpyvfjboor/files/3/d/5/dataset_3d511a01-2614-42aa-b356-a237953c120e.dat
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              log false
              tool_section {"tools": [{"__index__": 0, "select_tool": {"__current_case__": 19, "analysis_software_version": "1.1.0", "bam_file_path": {"values": [{"id": 6, "src": "hda"}]}, "contig_graph_path": {"values": [{"id": 5, "src": "hda"}]}, "input": {"values": [{"id": 4, "src": "hda"}]}, "reference_database_version": null, "tool_list": "shovill"}}, {"__index__": 1, "select_tool": {"__current_case__": 16, "analysis_software_version": "5.2.0", "input": {"values": [{"id": 7, "src": "hda"}]}, "quast_html_path": {"values": [{"id": 8, "src": "hda"}]}, "reference_database_version": null, "tool_list": "quast"}}, {"__index__": 2, "select_tool": {"__current_case__": 18, "analysis_software_version": "0.1.2", "input": {"values": [{"id": 11, "src": "hda"}]}, "reference_database_version": null, "tool_list": "refseqmasher"}}, {"__index__": 3, "select_tool": {"__current_case__": 3, "analysis_software_version": "2022.09", "bandage_plot_path": {"values": [{"id": 13, "src": "hda"}]}, "input": {"values": [{"id": 12, "src": "hda"}]}, "reference_database_version": null, "tool_list": "bandage"}}]}
      • Step 9: ToolDistillator summarize:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • tooldistillator --version && mkdir -p input_files && cp '/tmp/tmpyvfjboor/files/d/2/9/dataset_d2966201-97cb-426d-b355-375fc63e5d4b.dat' ./input_files/ && cp '/tmp/tmpyvfjboor/files/7/f/3/dataset_7f3c0950-7bb7-4383-b046-85cc0f994541.dat' ./input_files/ && cp '/tmp/tmpyvfjboor/files/4/5/6/dataset_45628b9e-d136-4f74-a14a-2484a5038f8d.dat' ./input_files/ && cp '/tmp/tmpyvfjboor/files/2/d/d/dataset_2dd63a6e-6cc7-4a8b-91dd-f252ec700a56.dat' ./input_files/ && tooldistillator summarize input_files/* -o summary.json

            Exit Code:

            • 0

            Standard Output:

            • tooldistillator 0.9
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "d0db26e479e211ef8c8b7f95f3421cd2"
              chromInfo "/tmp/tmpyvfjboor/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
    • Other invocation details
      • history_id

        • 5f7579c9a38003b0
      • history_state

        • ok
      • invocation_id

        • 5f7579c9a38003b0
      • invocation_state

        • scheduled
      • workflow_id

        • 5f7579c9a38003b0

@lldelisle

Copy link
Copy Markdown
Contributor
  • ❌ cutandrun.ga_0

    Problems:

    • Output with path /tmp/tmpv4oqhbww/MACS2 summits__d90a03e4-f403-4622-a7eb-10631a19fec0 different than expected
      Expected 1856+-0 lines in the output found 5870
      
    • Output with path /tmp/tmpdqlwqiuc/MACS2 narrowPeak__9d146526-4cf2-46c2-b1dc-6a6d54114f32 different than expected
      Expected 1856+-0 lines in the output found 5870
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: PE fastq input:

        • step_state: scheduled
      • Step 2: adapter_forward:

        • step_state: scheduled
      • Step 11: convert BAM to BED to improve peak calling:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpunwunqrf/files/d/9/8/dataset_d98adfb5-ff5f-4d1a-990b-48bf3ea5b9b4.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmpunwunqrf/job_working_directory/000/52/outputs/dataset_31eb2f04-bbd8-4dbc-aa4a-ae5d032c1c8e.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              dbkey "hg38"
              ed_score false
              option ""
              split false
              tag ""
      • Step 12: Call Peaks with MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmpunwunqrf/files/3/1/e/dataset_31eb2f04-bbd8-4dbc-aa4a-ae5d032c1c8e.dat'  --name Rep1    --format BED   --gsize '2700000000'           --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp Rep1_peaks.xls '/tmp/tmpunwunqrf/job_working_directory/000/53/outputs/dataset_18f853c4-463f-4f2b-8432-3dcd7ea97eef.dat'   && ( count=`ls -1 Rep1* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpunwunqrf/job_working_directory/000/53/outputs/dataset_6e65010a-3b6f-4ba8-9cfc-16f7f172a11f_files' && cp -r Rep1* '/tmp/tmpunwunqrf/job_working_directory/000/53/outputs/dataset_6e65010a-3b6f-4ba8-9cfc-16f7f172a11f_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpunwunqrf/job_working_directory/000/53/outputs/dataset_6e65010a-3b6f-4ba8-9cfc-16f7f172a11f_files' macs2_stderr > '/tmp/tmpunwunqrf/job_working_directory/000/53/outputs/dataset_6e65010a-3b6f-4ba8-9cfc-16f7f172a11f.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

            Exit Code:

            • 0

            Standard Output:

            • INFO  @ Mon, 23 Sep 2024 20:09:30: 
              # Command line: callpeak -t /tmp/tmpunwunqrf/files/3/1/e/dataset_31eb2f04-bbd8-4dbc-aa4a-ae5d032c1c8e.dat --name Rep1 --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
              # ARGUMENTS LIST:
              # name = Rep1
              # format = BED
              # ChIP-seq file = ['/tmp/tmpunwunqrf/files/3/1/e/dataset_31eb2f04-bbd8-4dbc-aa4a-ae5d032c1c8e.dat']
              # control file = None
              # effective genome size = 2.70e+09
              # band width = 300
              # model fold = [5, 50]
              # qvalue cutoff = 5.00e-02
              # The maximum gap between significant sites is assigned as the read length/tag size.
              # The minimum length of peaks is assigned as the predicted fragment length "d".
              # Larger dataset will be scaled towards smaller dataset.
              # Range for calculating regional lambda is: 10000 bps
              # Broad region calling is off
              # Paired-End mode is off
              # Searching for subpeak summits is on
               
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1 read tag files... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1 read treatment tags... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1 tag size is determined as 40 bps 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1 tag size = 40.0 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1  total tags in treatment: 238930 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #1 finished! 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #2 Build Peak Model... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #2 Skipped... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #2 Use 200 as fragment length 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #3 Call peaks... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #3 Going to call summits inside each peak ... 
              INFO  @ Mon, 23 Sep 2024 20:09:30: #3 Pre-compute pvalue-qvalue table... 
              INFO  @ Mon, 23 Sep 2024 20:09:31: #3 In the peak calling step, the following will be performed simultaneously: 
              INFO  @ Mon, 23 Sep 2024 20:09:31: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... Rep1_treat_pileup.bdg 
              INFO  @ Mon, 23 Sep 2024 20:09:31: #3   Write bedGraph files for control lambda (after scaling if necessary)... Rep1_control_lambda.bdg 
              INFO  @ Mon, 23 Sep 2024 20:09:31: #3   Pileup will be based on sequencing depth in treatment. 
              INFO  @ Mon, 23 Sep 2024 20:09:31: #3 Call peaks for each chromosome... 
              INFO  @ Mon, 23 Sep 2024 20:09:33: #4 Write output xls file... Rep1_peaks.xls 
              INFO  @ Mon, 23 Sep 2024 20:09:33: #4 Write peak in narrowPeak format file... Rep1_peaks.narrowPeak 
              INFO  @ Mon, 23 Sep 2024 20:09:33: #4 Write summits bed file... Rep1_summits.bed 
              INFO  @ Mon, 23 Sep 2024 20:09:33: Done! 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              advanced_options {"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false}
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              control {"__current_case__": 1, "c_select": "No"}
              cutoff_options {"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}
              dbkey "hg38"
              effective_genome_size_options {"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"}
              format "BED"
              nomodel_type {"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}
              outputs ["peaks_tabular", "summits", "bdg", "html"]
              treatment {"__current_case__": 0, "input_treatment_file": {"values": [{"id": 113, "src": "dce"}]}, "t_multi_select": "No"}
      • Step 13: summary of MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmpunwunqrf/files/1/8/f/dataset_18f853c4-463f-4f2b-8432-3dcd7ea97eef.dat' > '/tmp/tmpunwunqrf/job_working_directory/000/54/outputs/dataset_9eb23d23-faff-46d1-ad89-a56e3fd1c5f2.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              case_sensitive "-i"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              color "NOCOLOR"
              dbkey "hg38"
              invert ""
              lines_after "0"
              lines_before "0"
              regex_type "-P"
              url_paste "^#"
      • Step 14: Bigwig from MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -v "^track" '/tmp/tmpunwunqrf/files/7/2/a/dataset_72acc750-b6f1-4a05-9acd-e72fe1019763.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len' '/tmp/tmpunwunqrf/job_working_directory/000/55/outputs/dataset_7811c19b-1e29-4a14-83a5-05ff903ed3a6.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

            Exit Code:

            • 0

            Standard Error:

            • /tmp/tmpunwunqrf/job_working_directory/000/55/tool_script.sh: line 22:     7 Done                    grep -v "^track" '/tmp/tmpunwunqrf/files/7/2/a/dataset_72acc750-b6f1-4a05-9acd-e72fe1019763.dat'
                       8 Killed                  | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len' '/tmp/tmpunwunqrf/job_working_directory/000/55/outputs/dataset_7811c19b-1e29-4a14-83a5-05ff903ed3a6.dat' -clip 2>&1
              Error running wigToBigWig.
              

            Standard Output:

            • bedGraph error line 299599 of stdin: chromosome chrM has size 16569 but item ends at 16571
              bedGraph error line 299600 of stdin: chromosome chrM has size 16569 but item ends at 16574
              bedGraph error line 299601 of stdin: chromosome chrM has size 16569 but item ends at 16575
              bedGraph error line 299602 of stdin: chromosome chrM has size 16569 but item ends at 16578
              bedGraph error line 299603 of stdin: chromosome chrM has size 16569 but item ends at 16579
              bedGraph error line 299604 of stdin: chromosome chrM has size 16569 but item ends at 16580
              bedGraph error line 299605 of stdin: chromosome chrM has size 16569 but item ends at 16581
              bedGraph error line 299606 of stdin: chromosome chrM has size 16569 but item ends at 16582
              bedGraph error line 299607 of stdin: chromosome chrM has size 16569 but item ends at 16583
              bedGraph error line 299608 of stdin: chromosome chrM has size 16569 but item ends at 16584
              bedGraph error line 299609 of stdin: chromosome chrM has size 16569 but item ends at 16585
              bedGraph error line 299610 of stdin: chromosome chrM has size 16569 but item ends at 16586
              bedGraph error line 299611 of stdin: chromosome chrM has size 16569 but item ends at 16587
              bedGraph error line 299612 of stdin: chromosome chrM has size 16569 but item ends at 16588
              bedGraph error line 299613 of stdin: chromosome chrM has size 16569 but item ends at 16589
              bedGraph error line 299614 of stdin: chromosome chrM has size 16569 but item ends at 16590
              bedGraph error line 299615 of stdin: chromosome chrM has size 16569 but item ends at 16591
              bedGraph error line 299616 of stdin: chromosome chrM has size 16569 but item ends at 16592
              bedGraph error line 299617 of stdin: chromosome chrM has size 16569 but item ends at 16593
              bedGraph error line 299618 of stdin: chromosome chrM has size 16569 but item ends at 16595
              bedGraph error line 299619 of stdin: chromosome chrM has size 16569 but item ends at 16599
              bedGraph error line 299620 of stdin: chromosome chrM has size 16569 but item ends at 16601
              bedGraph error line 299621 of stdin: chromosome chrM has size 16569 but item ends at 16602
              bedGraph error line 299622 of stdin: chromosome chrM has size 16569 but item ends at 16603
              bedGraph error line 299623 of stdin: chromosome chrM has size 16569 but item ends at 16605
              bedGraph error line 299624 of stdin: chromosome chrM has size 16569 but item ends at 16606
              bedGraph error line 299625 of stdin: chromosome chrM has size 16569 but item ends at 16608
              bedGraph error line 299626 of stdin: chromosome chrM has size 16569 but item ends at 16609
              bedGraph error line 299627 of stdin: chromosome chrM has size 16569 but item ends at 16610
              bedGraph error line 299628 of stdin: chromosome chrM has size 16569 but item ends at 16611
              bedGraph error line 299629 of stdin: chromosome chrM has size 16569 but item ends at 16612
              bedGraph error line 299630 of stdin: chromosome chrM has size 16569 but item ends at 16613
              bedGraph error line 299631 of stdin: chromosome chrM has size 16569 but item ends at 16614
              bedGraph error line 299632 of stdin: chromosome chrM has size 16569 but item ends at 16615
              bedGraph error line 299633 of stdin: chromosome chrM has size 16569 but item ends at 16616
              bedGraph error line 299634 of stdin: chromosome chrM has size 16569 but item ends at 16617
              bedGraph error line 299635 of stdin: chromosome chrM has size 16569 but item ends at 16618
              bedGraph error line 299636 of stdin: chromosome chrM has size 16569 but item ends at 16619
              bedGraph error line 299637 of stdin: chromosome chrM has size 16569 but item ends at 16620
              bedGraph error line 299638 of stdin: chromosome chrM has size 16569 but item ends at 16621
              bedGraph error line 299639 of stdin: chromosome chrM has size 16569 but item ends at 16622
              bedGraph error line 299640 of stdin: chromosome chrM has size 16569 but item ends at 16623
              bedGraph error line 299641 of stdin: chromosome chrM has size 16569 but item ends at 16624
              bedGraph error line 299642 of stdin: chromosome chrM has size 16569 but item ends at 16627
              bedGraph error line 299643 of stdin: chromosome chrM has size 16569 but item ends at 16629
              bedGraph error line 299644 of stdin: chromosome chrM has size 16569 but item ends at 16630
              bedGraph error line 299645 of stdin: chromosome chrM has size 16569 but item ends at 16631
              bedGraph error line 299646 of stdin: chromosome chrM has size 16569 but item ends at 16632
              bedGraph error line 299647 of stdin: chromosome chrM has size 16569 but item ends at 16633
              bedGraph error line 299648 of stdin: chromosome chrM has size 16569 but item ends at 16634
              bedGraph error line 299649 of stdin: chromosome chrM has size 16569 but item ends at 16635
              bedGraph error line 299650 of stdin: chromosome chrM has size 16569 but item ends at 16639
              bedGraph error line 299651 of stdin: chromosome chrM has size 16569 but item ends at 16641
              bedGraph error line 299652 of stdin: chromosome chrM has size 16569 but item ends at 16642
              bedGraph error line 299653 of stdin: chromosome chrM has size 16569 but item ends at 16644
              bedGraph error line 299654 of stdin: chromosome chrM has size 16569 but item ends at 16645
              bedGraph error line 299655 of stdin: chromosome chrM has size 16569 but item ends at 16649
              bedGraph error line 299656 of stdin: chromosome chrM has size 16569 but item ends at 16650
              bedGraph error line 299657 of stdin: chromosome chrM has size 16569 but item ends at 16651
              bedGraph error line 299658 of stdin: chromosome chrM has size 16569 but item ends at 16652
              bedGraph error line 299659 of stdin: chromosome chrM has size 16569 but item ends at 16653
              bedGraph error line 299660 of stdin: chromosome chrM has size 16569 but item ends at 16654
              bedGraph error line 299661 of stdin: chromosome chrM has size 16569 but item ends at 16655
              bedGraph error line 299662 of stdin: chromosome chrM has size 16569 but item ends at 16656
              bedGraph error line 299663 of stdin: chromosome chrM has size 16569 but item ends at 16657
              bedGraph error line 299664 of stdin: chromosome chrM has size 16569 but item ends at 16661
              bedGraph error line 299665 of stdin: chromosome chrM has size 16569 but item ends at 16662
              bedGraph error line 299666 of stdin: chromosome chrM has size 16569 but item ends at 16663
              bedGraph error line 299667 of stdin: chromosome chrM has size 16569 but item ends at 16664
              bedGraph error line 299668 of stdin: chromosome chrM has size 16569 but item ends at 16666
              bedGraph error line 299669 of stdin: chromosome chrM has size 16569 but item ends at 16667
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "bedgraph"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              dbkey "hg38"
              settings {"__current_case__": 0, "settingsType": "preset"}
      • Step 15: MultiQC:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpunwunqrf/files/f/a/7/dataset_fa73de97-c9c8-4597-90a0-5b8e421fbf0f.dat' 'multiqc_WDir/cutadapt_0/Rep1.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/Rep1.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/Rep1.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&  mkdir multiqc_WDir/bowtie2_1 &&         grep -q '% overall alignment rate' /tmp/tmpunwunqrf/files/7/a/2/dataset_7a2daa4e-0eaa-4d4b-9dad-cab6998eb0e0.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'Rep1'" && ln -s '/tmp/tmpunwunqrf/files/7/a/2/dataset_7a2daa4e-0eaa-4d4b-9dad-cab6998eb0e0.dat' 'multiqc_WDir/bowtie2_1/Rep1'  &&    mkdir multiqc_WDir/picard_2 &&      mkdir 'multiqc_WDir/picard_2/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmpunwunqrf/files/8/4/5/dataset_845ce96c-167a-4337-9cb8-1c72fa11f866.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'Rep1'" && ln -s '/tmp/tmpunwunqrf/files/8/4/5/dataset_845ce96c-167a-4337-9cb8-1c72fa11f866.dat' 'multiqc_WDir/picard_2/markdups_0/Rep1'  &&    mkdir multiqc_WDir/macs2_3 &&    grep -q "# This file is generated by MACS" /tmp/tmpunwunqrf/files/1/8/f/dataset_18f853c4-463f-4f2b-8432-3dcd7ea97eef.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpunwunqrf/files/1/8/f/dataset_18f853c4-463f-4f2b-8432-3dcd7ea97eef.dat' 'multiqc_WDir/macs2_3/Rep1_peaks.xls' &&  multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

            Exit Code:

            • 0

            Standard Error:

            • /// MultiQC 🔍 v1.24.1
              
                   version_check | MultiQC Version v1.25 now available!
                     file_search | Search path: /tmp/tmpunwunqrf/job_working_directory/000/56/working/multiqc_WDir
              
                           macs2 | Found 1 logs
                          picard | Found 1 MarkDuplicates reports
                         bowtie2 | Found 1 reports
                        cutadapt | Found 1 reports
              
                   write_results | Data        : report_data
                   write_results | Report      : report.html
                   write_results | Plots       : report_plots
                         multiqc | MultiQC complete
              

            Standard Output:

            • total 156
              -rw-r--r-- 1 1001 127    189 Sep 23 20:10 bowtie2_pe_plot.txt
              -rw-r--r-- 1 1001 127     73 Sep 23 20:10 cutadapt_filtered_reads_plot.txt
              -rw-r--r-- 1 1001 127   1319 Sep 23 20:10 cutadapt_trimmed_sequences_plot_3_Counts.txt
              -rw-r--r-- 1 1001 127   1653 Sep 23 20:10 cutadapt_trimmed_sequences_plot_3_Obs_Exp.txt
              -rw-r--r-- 1 1001 127    394 Sep 23 20:10 multiqc_bowtie2.txt
              -rw-r--r-- 1 1001 127    425 Sep 23 20:10 multiqc_citations.txt
              -rw-r--r-- 1 1001 127    245 Sep 23 20:10 multiqc_cutadapt.txt
              -rw-r--r-- 1 1001 127 104208 Sep 23 20:10 multiqc_data.json
              -rw-r--r-- 1 1001 127    336 Sep 23 20:10 multiqc_general_stats.txt
              -rw-r--r-- 1 1001 127     90 Sep 23 20:10 multiqc_macs.txt
              -rw-r--r-- 1 1001 127    299 Sep 23 20:10 multiqc_picard_dups.txt
              -rw-r--r-- 1 1001 127     51 Sep 23 20:10 multiqc_software_versions.txt
              -rw-r--r-- 1 1001 127    503 Sep 23 20:10 multiqc_sources.txt
              -rw-r--r-- 1 1001 127     66 Sep 23 20:10 picard_deduplication.txt
              -rw-r--r-- 1 1001 127      0 Sep 23 20:10 picard_histogram.txt
              -rw-r--r-- 1 1001 127      0 Sep 23 20:10 picard_histogram_1.txt
              -rw-r--r-- 1 1001 127      0 Sep 23 20:10 picard_histogram_2.txt
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              comment ""
              dbkey "hg38"
              export true
              flat false
              results [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 34, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 36, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 38, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 3, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 41, "src": "hdca"}]}, "software": "macs2"}}]
              saveLog "false"
              title ""
      • Step 3: adapter_reverse:

        • step_state: scheduled
      • Step 4: reference_genome:

        • step_state: scheduled
      • Step 5: effective_genome_size:

        • step_state: scheduled
      • Step 6: normalize_profile:

        • step_state: scheduled
      • Step 7: Cutadapt (remove adapter + bad quality bases):

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -f -s '/tmp/tmpunwunqrf/files/8/4/c/dataset_84cae7a4-82b3-46ae-a7b1-6b90e711a117.dat' 'Rep1_1.fq' && ln -f -s '/tmp/tmpunwunqrf/files/5/b/c/dataset_5bc9dbf4-d6fc-4392-a876-5fc98111e627.dat' 'Rep1_2.fq' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -a 'Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC '='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'    -A 'Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA'='GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'    --error-rate=0.1 --times=1 --overlap=3    --action=trim   --quality-cutoff=30       --minimum-length=15      -o 'out1.fq' -p 'out2.fq'  'Rep1_1.fq' 'Rep1_2.fq'  > report.txt

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              adapter_options {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
              chromInfo "/tmp/tmpunwunqrf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              filter_options {"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"}
              library {"__current_case__": 2, "input_1": {"values": [{"id": 101, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_name": "Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC ", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "adapter_name": "Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
              other_trimming_options {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
              output_selector ["report"]
              read_mod_options {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}
      • Step 8: Bowtie2 map on reference:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmpunwunqrf/files/3/7/f/dataset_37f51cb6-831b-4c0d-8efb-7207b3fbaa34.dat' input_f.fastq &&  ln -f -s '/tmp/tmpunwunqrf/files/f/9/6/dataset_f9626129-ef55-48f0-a7cb-11b401fe52b4.dat' input_r.fastq &&    THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/hg38/hg38canon/bowtie2_index/hg38canon'   -1 'input_f.fastq' -2 'input_r.fastq' -I 0 -X 1000 --fr   --dovetail                --very-sensitive   2> >(tee '/tmp/tmpunwunqrf/job_working_directory/000/49/outputs/dataset_7a2daa4e-0eaa-4d4b-9dad-cab6998eb0e0.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmpunwunqrf/job_working_directory/000/49/outputs/dataset_8526f022-8c9f-4de1-b945-15397e0fccc4.dat'

            Exit Code:

            • 0

            Standard Error:

            • 289103 reads; of these:
                289103 (100.00%) were paired; of these:
                  2849 (0.99%) aligned concordantly 0 times
                  107861 (37.31%) aligned concordantly exactly 1 time
                  178393 (61.71%) aligned concordantly >1 times
                  ----
                  2849 pairs aligned concordantly 0 times; of these:
                    135 (4.74%) aligned discordantly 1 time
                  ----
                  2714 pairs aligned 0 times concordantly or discordantly; of these:
                    5428 mates make up the pairs; of these:
                      3547 (65.35%) aligned 0 times
                      740 (13.63%) aligned exactly 1 time
                      1141 (21.02%) aligned >1 times
              99.39% overall alignment rate
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              analysis_type {"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}
              chromInfo "/tmp/tmpunwunqrf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              library {"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 104, "src": "dce"}]}, "paired_options": {"I": "0", "X": "1000", "__current_case__": 0, "dovetail": true, "fr_rf_ff": "--fr", "no_contain": false, "no_discordant": false, "no_mixed": false, "no_overlap": false, "paired_options_selector": "yes"}, "type": "paired_collection", "unaligned_file": false}
              reference_genome {"__current_case__": 0, "index": "hg38canon", "source": "indexed"}
              rg {"__current_case__": 3, "rg_selector": "do_not_set"}
              sam_options {"__current_case__": 1, "sam_options_selector": "no"}
              save_mapping_stats true
      • Step 9: filter MAPQ30 concordant pairs:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpunwunqrf/files/8/5/2/dataset_8526f022-8c9f-4de1-b945-15397e0fccc4.dat' input.bam && ln -s '/tmp/tmpunwunqrf/files/_metadata_files/0/e/8/metadata_0e8ea25f-e2ab-4e32-a7c7-ed5891fcdc38.dat' input.bai && samtools view -o '/tmp/tmpunwunqrf/job_working_directory/000/50/outputs/dataset_0b763c7e-cbfa-413b-9f46-890d48d457ba.dat' -h   -b  -q 30 -f 0x2 input.bam

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "bam"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              bed_file None
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              dbkey "hg38"
              flag {"__current_case__": 1, "filter": "yes", "reqBits": ["0x0002"], "skipBits": null}
              header "-h"
              library ""
              mapq "30"
              outputtype "bam"
              possibly_select_inverse false
              read_group ""
              regions ""
      • Step 10: remove PCR duplicates:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • _JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmpunwunqrf/files/0/b/7/dataset_0b763c7e-cbfa-413b-9f46-890d48d457ba.dat' 'Rep1' &&  picard MarkDuplicates  --INPUT 'Rep1' --OUTPUT '/tmp/tmpunwunqrf/job_working_directory/000/51/outputs/dataset_d98adfb5-ff5f-4d1a-990b-48bf3ea5b9b4.dat'  --METRICS_FILE '/tmp/tmpunwunqrf/job_working_directory/000/51/outputs/dataset_845ce96c-167a-4337-9cb8-1c72fa11f866.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

            Exit Code:

            • 0

            Standard Error:

            • /usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
              Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmpunwunqrf/tmp
              Sep 23, 2024 8:08:53 PM com.intel.gkl.NativeLibraryLoader load
              INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "c6bb3a3879e611ef828de1d8d6c74011"
              assume_sorted true
              barcode_tag ""
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg38.len"
              comments []
              dbkey "hg38"
              duplicate_scoring_strategy "SUM_OF_BASE_QUALITIES"
              optical_duplicate_pixel_distance "100"
              read_name_regex ""
              remove_duplicates true
              validation_stringency "LENIENT"
    • Other invocation details
      • history_id

        • e464cb905b8b8f6f
      • history_state

        • ok
      • invocation_id

        • d6e9162509d5b812
      • invocation_state

        • scheduled
      • workflow_id

        • 0781c546ca092175

@lldelisle

Copy link
Copy Markdown
Contributor
  • ❌ cutandrun.ga_1

    Problems:

    • Output with path /tmp/tmptc98ti8u/MACS2 summits__95403a16-d719-494b-bad9-0db75791908c different than expected
      Expected 3261+-0 lines in the output found 3231
      
    • Output with path /tmp/tmpmvgzr969/MACS2 narrowPeak__c1b8283a-8dc5-4d7e-98a9-ebb24692c02b different than expected
      Expected 3261+-0 lines in the output found 3231
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: PE fastq input:

        • step_state: scheduled
      • Step 2: adapter_forward:

        • step_state: scheduled
      • Step 11: convert BAM to BED to improve peak calling:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpunwunqrf/files/f/c/4/dataset_fc46a058-7c5e-4346-a1ba-9852a082c6af.dat' ./input.bam &&  bedtools bamtobed    -i ./input.bam > '/tmp/tmpunwunqrf/job_working_directory/000/63/outputs/dataset_271b2210-a9db-44b0-b02e-ac11387ea8f7.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              dbkey "dm6"
              ed_score false
              option ""
              split false
              tag ""
      • Step 12: Call Peaks with MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmpunwunqrf/files/2/7/1/dataset_271b2210-a9db-44b0-b02e-ac11387ea8f7.dat'  --name Rep1    --format BED   --gsize '120000000'      --SPMR     --call-summits  --keep-dup 'all'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '-100'  2>&1 > macs2_stderr) && cp Rep1_peaks.xls '/tmp/tmpunwunqrf/job_working_directory/000/64/outputs/dataset_b40c31fb-ef4d-4a9d-b4dd-9c3549c40d1d.dat'   && ( count=`ls -1 Rep1* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpunwunqrf/job_working_directory/000/64/outputs/dataset_11d732a6-0021-4365-b2ea-a62e2a79e64a_files' && cp -r Rep1* '/tmp/tmpunwunqrf/job_working_directory/000/64/outputs/dataset_11d732a6-0021-4365-b2ea-a62e2a79e64a_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpunwunqrf/job_working_directory/000/64/outputs/dataset_11d732a6-0021-4365-b2ea-a62e2a79e64a_files' macs2_stderr > '/tmp/tmpunwunqrf/job_working_directory/000/64/outputs/dataset_11d732a6-0021-4365-b2ea-a62e2a79e64a.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

            Exit Code:

            • 0

            Standard Output:

            • INFO  @ Mon, 23 Sep 2024 20:16:46: 
              # Command line: callpeak -t /tmp/tmpunwunqrf/files/2/7/1/dataset_271b2210-a9db-44b0-b02e-ac11387ea8f7.dat --name Rep1 --format BED --gsize 120000000 --SPMR --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
              # ARGUMENTS LIST:
              # name = Rep1
              # format = BED
              # ChIP-seq file = ['/tmp/tmpunwunqrf/files/2/7/1/dataset_271b2210-a9db-44b0-b02e-ac11387ea8f7.dat']
              # control file = None
              # effective genome size = 1.20e+08
              # band width = 300
              # model fold = [5, 50]
              # qvalue cutoff = 5.00e-02
              # The maximum gap between significant sites is assigned as the read length/tag size.
              # The minimum length of peaks is assigned as the predicted fragment length "d".
              # Larger dataset will be scaled towards smaller dataset.
              # Range for calculating regional lambda is: 10000 bps
              # Broad region calling is off
              # Paired-End mode is off
              # Searching for subpeak summits is on
              # MACS will save fragment pileup signal per million reads
               
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1 read tag files... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1 read treatment tags... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1 tag size is determined as 36 bps 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1 tag size = 36.0 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1  total tags in treatment: 489716 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #1 finished! 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #2 Build Peak Model... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #2 Skipped... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #2 Use 200 as fragment length 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #2 Sequencing ends will be shifted towards 5' by 100 bp(s) 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #3 Call peaks... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #3 Going to call summits inside each peak ... 
              INFO  @ Mon, 23 Sep 2024 20:16:46: #3 Pre-compute pvalue-qvalue table... 
              INFO  @ Mon, 23 Sep 2024 20:16:47: #3 In the peak calling step, the following will be performed simultaneously: 
              INFO  @ Mon, 23 Sep 2024 20:16:47: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... Rep1_treat_pileup.bdg 
              INFO  @ Mon, 23 Sep 2024 20:16:47: #3   Write bedGraph files for control lambda (after scaling if necessary)... Rep1_control_lambda.bdg 
              INFO  @ Mon, 23 Sep 2024 20:16:47: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
              INFO  @ Mon, 23 Sep 2024 20:16:47: #3 Call peaks for each chromosome... 
              INFO  @ Mon, 23 Sep 2024 20:16:49: #4 Write output xls file... Rep1_peaks.xls 
              INFO  @ Mon, 23 Sep 2024 20:16:49: #4 Write peak in narrowPeak format file... Rep1_peaks.narrowPeak 
              INFO  @ Mon, 23 Sep 2024 20:16:49: #4 Write summits bed file... Rep1_summits.bed 
              INFO  @ Mon, 23 Sep 2024 20:16:49: Done! 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              advanced_options {"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false}
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              control {"__current_case__": 1, "c_select": "No"}
              cutoff_options {"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}
              dbkey "dm6"
              effective_genome_size_options {"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "120000000"}
              format "BED"
              nomodel_type {"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"}
              outputs ["peaks_tabular", "summits", "bdg", "html"]
              treatment {"__current_case__": 0, "input_treatment_file": {"values": [{"id": 138, "src": "dce"}]}, "t_multi_select": "No"}
      • Step 13: summary of MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmpunwunqrf/files/b/4/0/dataset_b40c31fb-ef4d-4a9d-b4dd-9c3549c40d1d.dat' > '/tmp/tmpunwunqrf/job_working_directory/000/65/outputs/dataset_83795e28-3451-4909-a83f-506720a4f2a3.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              case_sensitive "-i"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              color "NOCOLOR"
              dbkey "dm6"
              invert ""
              lines_after "0"
              lines_before "0"
              regex_type "-P"
              url_paste "^#"
      • Step 14: Bigwig from MACS2:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -v "^track" '/tmp/tmpunwunqrf/files/3/8/e/dataset_38e76b6c-759c-4359-853e-a54b397eaf08.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len' '/tmp/tmpunwunqrf/job_working_directory/000/66/outputs/dataset_95f18d6a-df74-48f6-b70c-c4666188626d.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

            Exit Code:

            • 0

            Standard Output:

            • bedGraph error line 807928 of stdin: chromosome chrUn_DS483753v1 has size 7123 but item ends at 7188
              bedGraph error line 808264 of stdin: chromosome chrUn_DS484314v1 has size 2381 but item ends at 2404
              bedGraph error line 808265 of stdin: chromosome chrUn_DS484314v1 has size 2381 but item ends at 2410
              bedGraph error line 808266 of stdin: chromosome chrUn_DS484314v1 has size 2381 but item ends at 2444
              bedGraph error line 808267 of stdin: chromosome chrUn_DS484314v1 has size 2381 but item ends at 2455
              bedGraph error line 808382 of stdin: chromosome chrUn_DS484954v1 has size 1323 but item ends at 1332
              bedGraph error line 808424 of stdin: chromosome chrUn_DS485636v1 has size 1088 but item ends at 1157
              bedGraph error line 925248 of stdin: chromosome chrX_DS484683v1_random has size 1679 but item ends at 1774
              bedGraph error line 925294 of stdin: chromosome chrX_DS485112v1_random has size 1238 but item ends at 1328
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "bedgraph"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              dbkey "dm6"
              settings {"__current_case__": 0, "settingsType": "preset"}
      • Step 15: MultiQC:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpunwunqrf/files/b/0/4/dataset_b047ac74-c55c-484a-bdc5-a251674c38e2.dat' 'multiqc_WDir/cutadapt_0/Rep1.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/Rep1.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/Rep1.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&  mkdir multiqc_WDir/bowtie2_1 &&         grep -q '% overall alignment rate' /tmp/tmpunwunqrf/files/5/a/f/dataset_5afdb462-2f50-420d-a336-abf83b30cac0.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'Rep1'" && ln -s '/tmp/tmpunwunqrf/files/5/a/f/dataset_5afdb462-2f50-420d-a336-abf83b30cac0.dat' 'multiqc_WDir/bowtie2_1/Rep1'  &&    mkdir multiqc_WDir/picard_2 &&      mkdir 'multiqc_WDir/picard_2/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmpunwunqrf/files/e/4/2/dataset_e4273967-eeab-4b8f-9dd1-886023cff696.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'Rep1'" && ln -s '/tmp/tmpunwunqrf/files/e/4/2/dataset_e4273967-eeab-4b8f-9dd1-886023cff696.dat' 'multiqc_WDir/picard_2/markdups_0/Rep1'  &&    mkdir multiqc_WDir/macs2_3 &&    grep -q "# This file is generated by MACS" /tmp/tmpunwunqrf/files/b/4/0/dataset_b40c31fb-ef4d-4a9d-b4dd-9c3549c40d1d.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpunwunqrf/files/b/4/0/dataset_b40c31fb-ef4d-4a9d-b4dd-9c3549c40d1d.dat' 'multiqc_WDir/macs2_3/Rep1_peaks.xls' &&  multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

            Exit Code:

            • 0

            Standard Error:

            • /// MultiQC 🔍 v1.24.1
              
                   version_check | MultiQC Version v1.25 now available!
                     file_search | Search path: /tmp/tmpunwunqrf/job_working_directory/000/67/working/multiqc_WDir
              
                           macs2 | Found 1 logs
                          picard | Found 1 MarkDuplicates reports
                         bowtie2 | Found 1 reports
                        cutadapt | Found 1 reports
              
                   write_results | Data        : report_data
                   write_results | Report      : report.html
                   write_results | Plots       : report_plots
                         multiqc | MultiQC complete
              

            Standard Output:

            • total 144
              -rw-r--r-- 1 1001 127   190 Sep 23 20:17 bowtie2_pe_plot.txt
              -rw-r--r-- 1 1001 127    72 Sep 23 20:17 cutadapt_filtered_reads_plot.txt
              -rw-r--r-- 1 1001 127   816 Sep 23 20:17 cutadapt_trimmed_sequences_plot_3_Counts.txt
              -rw-r--r-- 1 1001 127  1113 Sep 23 20:17 cutadapt_trimmed_sequences_plot_3_Obs_Exp.txt
              -rw-r--r-- 1 1001 127   399 Sep 23 20:17 multiqc_bowtie2.txt
              -rw-r--r-- 1 1001 127   425 Sep 23 20:17 multiqc_citations.txt
              -rw-r--r-- 1 1001 127   242 Sep 23 20:17 multiqc_cutadapt.txt
              -rw-r--r-- 1 1001 127 91801 Sep 23 20:17 multiqc_data.json
              -rw-r--r-- 1 1001 127   348 Sep 23 20:17 multiqc_general_stats.txt
              -rw-r--r-- 1 1001 127    90 Sep 23 20:17 multiqc_macs.txt
              -rw-r--r-- 1 1001 127   299 Sep 23 20:17 multiqc_picard_dups.txt
              -rw-r--r-- 1 1001 127    51 Sep 23 20:17 multiqc_software_versions.txt
              -rw-r--r-- 1 1001 127   503 Sep 23 20:17 multiqc_sources.txt
              -rw-r--r-- 1 1001 127    63 Sep 23 20:17 picard_deduplication.txt
              -rw-r--r-- 1 1001 127     0 Sep 23 20:17 picard_histogram.txt
              -rw-r--r-- 1 1001 127     0 Sep 23 20:17 picard_histogram_1.txt
              -rw-r--r-- 1 1001 127     0 Sep 23 20:17 picard_histogram_2.txt
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              comment ""
              dbkey "dm6"
              export true
              flat false
              results [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 52, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 54, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 56, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 3, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 59, "src": "hdca"}]}, "software": "macs2"}}]
              saveLog "false"
              title ""
      • Step 3: adapter_reverse:

        • step_state: scheduled
      • Step 4: reference_genome:

        • step_state: scheduled
      • Step 5: effective_genome_size:

        • step_state: scheduled
      • Step 6: normalize_profile:

        • step_state: scheduled
      • Step 7: Cutadapt (remove adapter + bad quality bases):

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -f -s '/tmp/tmpunwunqrf/files/3/c/e/dataset_3cef7ed8-2b20-4f4d-bada-e3eeae445a5b.dat' 'Rep1_1.fq' && ln -f -s '/tmp/tmpunwunqrf/files/5/9/e/dataset_59e6d66f-257f-46d8-9d60-84f1c9e6130f.dat' 'Rep1_2.fq' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -a 'Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC '='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'    -A 'Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA'='GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'    --error-rate=0.1 --times=1 --overlap=3    --action=trim   --quality-cutoff=30       --minimum-length=15      -o 'out1.fq' -p 'out2.fq'  'Rep1_1.fq' 'Rep1_2.fq'  > report.txt

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              adapter_options {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
              chromInfo "/tmp/tmpunwunqrf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              filter_options {"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"}
              library {"__current_case__": 2, "input_1": {"values": [{"id": 126, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_name": "Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC ", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "adapter_name": "Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
              other_trimming_options {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
              output_selector ["report"]
              read_mod_options {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}
      • Step 8: Bowtie2 map on reference:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmpunwunqrf/files/7/c/2/dataset_7c24aa32-0b1e-4f0a-9f92-6157c19a0c31.dat' input_f.fastq &&  ln -f -s '/tmp/tmpunwunqrf/files/f/d/4/dataset_fd4b26dd-8969-4465-92af-475d997c2e67.dat' input_r.fastq &&    THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/managed/bowtie2_index/dm6/dm6'   -1 'input_f.fastq' -2 'input_r.fastq' -I 0 -X 1000 --fr   --dovetail                --very-sensitive   2> >(tee '/tmp/tmpunwunqrf/job_working_directory/000/60/outputs/dataset_5afdb462-2f50-420d-a336-abf83b30cac0.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmpunwunqrf/job_working_directory/000/60/outputs/dataset_2b76d613-0d8f-46f0-bdec-55239d23db3c.dat'

            Exit Code:

            • 0

            Standard Error:

            • 343237 reads; of these:
                343237 (100.00%) were paired; of these:
                  15422 (4.49%) aligned concordantly 0 times
                  246111 (71.70%) aligned concordantly exactly 1 time
                  81704 (23.80%) aligned concordantly >1 times
                  ----
                  15422 pairs aligned concordantly 0 times; of these:
                    438 (2.84%) aligned discordantly 1 time
                  ----
                  14984 pairs aligned 0 times concordantly or discordantly; of these:
                    29968 mates make up the pairs; of these:
                      12578 (41.97%) aligned 0 times
                      10963 (36.58%) aligned exactly 1 time
                      6427 (21.45%) aligned >1 times
              98.17% overall alignment rate
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              analysis_type {"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}
              chromInfo "/tmp/tmpunwunqrf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              library {"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 129, "src": "dce"}]}, "paired_options": {"I": "0", "X": "1000", "__current_case__": 0, "dovetail": true, "fr_rf_ff": "--fr", "no_contain": false, "no_discordant": false, "no_mixed": false, "no_overlap": false, "paired_options_selector": "yes"}, "type": "paired_collection", "unaligned_file": false}
              reference_genome {"__current_case__": 0, "index": "dm6", "source": "indexed"}
              rg {"__current_case__": 3, "rg_selector": "do_not_set"}
              sam_options {"__current_case__": 1, "sam_options_selector": "no"}
              save_mapping_stats true
      • Step 9: filter MAPQ30 concordant pairs:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpunwunqrf/files/2/b/7/dataset_2b76d613-0d8f-46f0-bdec-55239d23db3c.dat' input.bam && ln -s '/tmp/tmpunwunqrf/files/_metadata_files/f/f/4/metadata_ff4f773c-4c0b-46d5-9ec9-e7403e5f60cc.dat' input.bai && samtools view -o '/tmp/tmpunwunqrf/job_working_directory/000/61/outputs/dataset_9ca4f3c7-564c-4b0f-a246-73c5dff94c81.dat' -h   -b  -q 30 -f 0x2 input.bam

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "bam"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              bed_file None
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              dbkey "dm6"
              flag {"__current_case__": 1, "filter": "yes", "reqBits": ["0x0002"], "skipBits": null}
              header "-h"
              library ""
              mapq "30"
              outputtype "bam"
              possibly_select_inverse false
              read_group ""
              regions ""
      • Step 10: remove PCR duplicates:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • _JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmpunwunqrf/files/9/c/a/dataset_9ca4f3c7-564c-4b0f-a246-73c5dff94c81.dat' 'Rep1' &&  picard MarkDuplicates  --INPUT 'Rep1' --OUTPUT '/tmp/tmpunwunqrf/job_working_directory/000/62/outputs/dataset_fc46a058-7c5e-4346-a1ba-9852a082c6af.dat'  --METRICS_FILE '/tmp/tmpunwunqrf/job_working_directory/000/62/outputs/dataset_e4273967-eeab-4b8f-9dd1-886023cff696.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

            Exit Code:

            • 0

            Standard Error:

            • /usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
              Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmpunwunqrf/tmp
              Sep 23, 2024 8:16:25 PM com.intel.gkl.NativeLibraryLoader load
              INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "ef3e234879e711ef828de1d8d6c74011"
              assume_sorted true
              barcode_tag ""
              chromInfo "/cvmfs/data.galaxyproject.org/managed/len/ucsc/dm6.len"
              comments []
              dbkey "dm6"
              duplicate_scoring_strategy "SUM_OF_BASE_QUALITIES"
              optical_duplicate_pixel_distance "100"
              read_name_regex ""
              remove_duplicates true
              validation_stringency "LENIENT"
    • Other invocation details
      • history_id

        • d6e9162509d5b812
      • history_state

        • ok
      • invocation_id

        • 0781c546ca092175
      • invocation_state

        • scheduled
      • workflow_id

        • 0781c546ca092175

@lldelisle

Copy link
Copy Markdown
Contributor
  • ❌ gromacs-dctmd.ga_0

    Problems:

    • Output with path /tmp/tmpa2rb1ok4/Free energy data__e463ef05-f7de-4501-8cbc-1bc1ff138847 different than expected
      Expected 101+-0 lines in the output found 102
      
    • Output with path /tmp/tmp2je46tu1/Friction data__4cc44366-08fd-41c9-af8b-eb8afbde0b93 different than expected
      Expected 101+-0 lines in the output found 102
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: Ligand SDF:

        • step_state: scheduled
      • Step 2: pH to protonate ligand:

        • step_state: scheduled
      • Step 11: Pulling rate:

        • step_state: scheduled
      • Step 12: Step length (ps):

        • step_state: scheduled
      • Step 13: Protein pull group:

        • step_state: scheduled
      • Step 14: Number of steps:

        • step_state: scheduled
      • Step 15: Pull group pbcatom:

        • step_state: scheduled
      • Step 16: Unlabelled step:

        • step_state: scheduled

        • Subworkflow Steps
          • Step 1: Ligand SDF:

            • step_state: scheduled
          • Step 2: pH:

            • step_state: scheduled
          • Step 11: param_value_from_file:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  param_type "integer"
                  remove_newlines true
          • Step 12: toolshed.g2.bx.psu.edu/repos/chemteam/ambertools_antechamber/ambertools_antechamber/21.10+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • antechamber -i '/tmp/tmplsidlzey/files/e/7/1/dataset_e7193935-64d8-4366-ab8f-878ffa4d8910.dat' -o '/tmp/tmplsidlzey/job_working_directory/000/51/outputs/dataset_719be22d-f748-4ddd-814f-5bc5a07f1da3.dat' -fi 'pdb' -fo 'mol2' -c 'bcc' -pf 'yes' -nc '-1' -at 'gaff' -j '4' -rn 'UNL' -m '1'

                Exit Code:

                • 0

                Standard Error:

                • sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  

                Standard Output:

                • Welcome to antechamber 21.0: molecular input file processor.
                  
                  acdoctor mode is on: check and diagnose problems in the input file.
                  The atom type is set to gaff; the options available to the -at flag are
                      gaff, gaff2, amber, bcc, and sybyl.
                  -- Check Format for pdb File --
                     Status: pass
                  -- Check Unusual Elements --
                     Status: pass
                  -- Check Open Valences --
                  Warning: This molecule has no hydrogens nor halogens.
                           It is quite possible that there are unfilled valences.
                  -- Check Geometry --
                        for those bonded   
                        for those not bonded   
                     Status: pass
                  -- Check Weird Bonds --
                     Status: pass
                  -- Check Number of Units --
                     Status: pass
                  acdoctor mode has completed checking the input file.
                  
                  Warning: The assigned bond types may be wrong, please :
                  (1) double check the structure (the connectivity) and/or 
                  (2) adjust atom valence penalty parameters in APS.DAT, and/or 
                  (3) increase PSCUTOFF in define.h and recompile bondtype.c
                      (be cautious, using a large value of PSCUTOFF (>100) will 
                      significantly increase the computation time).
                  Info: Total number of electrons: 136; net charge: -1
                  
                  Running: /usr/local/bin/sqm -O -i sqm.in -o sqm.out
                  
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pdb"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  allparams {"at": "gaff", "c": "bcc", "j": "4", "m": "1", "nc": "-1", "resname": "UNL"}
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  extraparams {"pf": true, "usenc": true}
                  selected_output_format "mol2"
          • Step 13: toolshed.g2.bx.psu.edu/repos/chemteam/ambertools_acpype/ambertools_acpype/21.10+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • ln -s '/tmp/tmplsidlzey/files/7/1/9/dataset_719be22d-f748-4ddd-814f-5bc5a07f1da3.dat' ./input1.mol2 && acpype -i './input1.mol2' -n '-1' -b base -m '1' -a 'gaff' -c 'user' -o gmx

                Exit Code:

                • 0

                Standard Output:

                • ========================================================================================
                  | ACPYPE: AnteChamber PYthon Parser interfacE v. 2021-02-05T22:15:50CET (c) 2024 AWSdS |
                  ========================================================================================
                  ==> Reading user's charges from mol2 file...
                  ==> ... charge set to -1
                  ==> Executing Antechamber...
                  ==> * Antechamber OK *
                  ==> * Parmchk OK *
                  ==> Executing Tleap...
                  ++++++++++start_quote+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
                  Checking 'UNL'....
                  
                  /usr/local/bin/teLeap: Warning!
                  The unperturbed charge of the unit (-1.001000) is not zero.
                  Checking parameters for unit 'UNL'.
                  Checking for bond parameters.
                  Checking for angle parameters.
                  check: Warnings: 1
                  Unit is OK.
                  ++++++++++end_quote+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
                  ==> * Tleap OK *
                  ==> Removing temporary files...
                  ==> Writing GROMACS files
                  
                  ==> Writing GMX dihedrals for GMX 4.5 and higher.
                  
                  ==> Writing pickle file base.pkl
                  Total time of execution: less than a second
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "mol2"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  atomtype "gaff"
                  charge "-1"
                  charge_method "user"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  multiplicity "1"
                  save_gro true
          • Step 14: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_merge_topology_files/gmx_merge_topology_files/3.4.3+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/gmx_merge_topology_files/bc31d02be922/gmx_merge_topology_files/merge_top.py' --lig-top /tmp/tmplsidlzey/files/1/c/c/dataset_1cc58d91-ad77-419b-9bfd-0edd2ff5c6df.dat --prot-top /tmp/tmplsidlzey/files/9/1/6/dataset_91605c8d-9405-4d05-95b1-cd4c7a55d053.dat --lig-gro /tmp/tmplsidlzey/files/6/f/b/dataset_6fbb03ba-580a-4c8e-bb2e-4951c3608c60.dat --prot-gro /tmp/tmplsidlzey/files/a/e/b/dataset_aeb567f9-9a27-4c4a-962c-68cdb94e9cba.dat --complex-top complex.top --complex-gro complex.gro

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "top"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
          • Step 3: Apoprotein PDB:

            • step_state: scheduled
          • Step 4: Water model:

            • step_state: scheduled
          • Step 5: Force field:

            • step_state: scheduled
          • Step 6: toolshed.g2.bx.psu.edu/repos/bgruening/ctb_rdkit_descriptors/ctb_rdkit_descriptors/2020.03.4+galaxy1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/ctb_rdkit_descriptors/0993ac4f4a23/ctb_rdkit_descriptors/rdkit_descriptors.py' -i '/tmp/tmplsidlzey/files/a/1/f/dataset_a1f86938-cc96-4f3d-b9dd-791229ea95dc.dat' --iformat 'sdf' -o '/tmp/tmplsidlzey/job_working_directory/000/33/outputs/dataset_863dfda3-3aca-429f-a48c-b57f7381ed09.dat' -s 'FormalCharge'

                Exit Code:

                • 0

                Standard Error:

                • [23:56:22] ERROR: End of data field name not found
                  [23:56:22] ERROR: moving to the beginning of the next molecule
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "sdf"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  header false
                  select_multiple ["FormalCharge"]
          • Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/openbabel_compound_convert/openbabel_compound_convert/3.1.1+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • obabel -i 'sdf'  '/tmp/tmplsidlzey/files/a/1/f/dataset_a1f86938-cc96-4f3d-b9dd-791229ea95dc.dat' -o 'pdb' -O '/tmp/tmplsidlzey/job_working_directory/000/34/outputs/dataset_4d468c90-ae87-4830-9c76-40378204e820.dat' -e

                Exit Code:

                • 0

                Standard Error:

                • 1 molecule converted
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "sdf"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  appendtotitle ""
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dative_bonds false
                  dbkey "?"
                  oformat {"__current_case__": 51, "oformat_opts_selector": "pdb"}
                  ph "-1.0"
                  remove_h false
                  split false
                  unique {"__current_case__": 0, "unique_opts_selector": ""}
          • Step 8: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_setup/gmx_setup/2022+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • ln -s '/tmp/tmplsidlzey/files/d/2/0/dataset_d202d279-99a1-4c1d-aea0-5581624ee55a.dat' ./pdb_input.pdb && gmx pdb2gmx -f ./pdb_input.pdb -o processed.gro -p topol.top -i posres.itp -water tip3p -ff amber99sb -noignh -merge all &>> verbose.txt

                Exit Code:

                • 0

                Standard Output:

                • WARNING: No ICDs were found. Either,
                  - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
                  - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pqr"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  capture_log true
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  ff "amber99sb"
                  ignore_h false
                  water "tip3p"
          • Step 9: Cut1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl '/tmp/tmplsidlzey/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmplsidlzey/files/8/6/3/dataset_863dfda3-3aca-429f-a48c-b57f7381ed09.dat' 'c2' T '/tmp/tmplsidlzey/job_working_directory/000/36/outputs/dataset_d75fabe2-a817-4878-8b4f-62574adc9d58.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  columnList "c2"
                  dbkey "?"
                  delimiter "T"
          • Step 10: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • grep -P -A 0 -B 0  -i -- "HETATM" '/tmp/tmplsidlzey/files/4/d/4/dataset_4d468c90-ae87-4830-9c76-40378204e820.dat' | grep -v "^--$" > "/tmp/tmplsidlzey/job_working_directory/000/37/outputs/dataset_e7193935-64d8-4366-ab8f-878ffa4d8910.dat"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pdb"
                  __workflow_invocation_uuid__ "519d38d57a0711efb46553e5001e451b"
                  case_sensitive "-i"
                  chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  color "NOCOLOR"
                  dbkey "?"
                  invert ""
                  lines_after "0"
                  lines_before "0"
                  regex_type "-P"
                  url_paste "HETATM"
      • Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/1.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • times=2; yes -- "300" 2>/dev/null | head -n $times >> /tmp/tmplsidlzey/job_working_directory/000/39/outputs/dataset_1fb4c1e8-042f-451c-a50b-1013af10b18d.dat;

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "data"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              token_set [{"__index__": 0, "line": "300", "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "2"}}]
      • Step 18: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "pull_coord1_rate = ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 2, "component_value": "0.001", "select_param_type": "float"}}]
              dbkey "?"
      • Step 19: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "dt = ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 2, "component_value": "0.001", "select_param_type": "float"}}]
              dbkey "?"
      • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "nsteps = ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "100", "select_param_type": "integer"}}]
              dbkey "?"
      • Step 3: Protein PDB:

        • step_state: scheduled
      • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              components [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": " pull-group1-pbcatom = ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "606", "select_param_type": "integer"}}]
              dbkey "?"
      • Step 22: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_solvate/gmx_solvate/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/job_working_directory/000/54/configs/tmphdkn0lu0' ./ions.mdp && ln -s '/tmp/tmplsidlzey/files/6/5/1/dataset_6517e2d9-8ca2-4675-884f-8add321a93c5.dat' ./gro_input.gro && ln -s '/tmp/tmplsidlzey/files/4/e/1/dataset_4e1d3d37-0d40-4922-a21c-e503587f07bb.dat' ./top_input.top &&  gmx solvate -cp ./gro_input.gro -cs spc216.gro -o solv.gro -p ./top_input.top &>> verbose.txt && gmx grompp -f ./ions.mdp -c solv.gro -p ./top_input.top -o ions.tpr -maxwarn '0' &>> verbose.txt && echo 'SOL' | gmx genion -s ions.tpr -o solv_ions.gro -p ./top_input.top -pname NA -nname CL -neutral -conc 0.1 -seed 1 &>> verbose.txt && mv solv_ions.gro solv.gro

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log false
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              conc "0.1"
              dbkey "?"
              mxw "0"
              neutralise "-neutral"
              seed "1"
              water_model "spc216"
      • Step 23: toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir ./out && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/6cbe2f30c2d7/split_file_to_collection/split_file_to_collection.py' --out ./out --in '/tmp/tmplsidlzey/files/1/f/b/dataset_1fb4c1e8-042f-451c-a50b-1013af10b18d.dat' --ftype 'txt' --chunksize 1 --file_names 'split_file' --file_ext 'txt'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              split_parms {"__current_case__": 5, "input": {"values": [{"id": 81, "src": "hda"}]}, "newfilenames": "split_file", "select_allocate": {"__current_case__": 2, "allocate": "byrow"}, "select_ftype": "txt", "select_mode": {"__current_case__": 0, "chunksize": "1", "mode": "chunk"}}
      • Step 24: toolshed.g2.bx.psu.edu/repos/bgruening/add_line_to_file/add_line_to_file/0.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/f/4/b/dataset_f4b0af2c-dcbf-45b4-b85d-2f149c2c07ee.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/45/outputs/dataset_e07715bf-259f-43af-967b-a105df885800.dat' && echo 'pull_coord1_rate = 0.001' >> '/tmp/tmplsidlzey/job_working_directory/000/45/outputs/dataset_e07715bf-259f-43af-967b-a105df885800.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              options "footer"
              text_input "pull_coord1_rate = 0.001"
      • Step 25: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_em/gmx_em/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/job_working_directory/000/55/configs/tmp1fh5x517' ./minim.mdp &&  ln -s '/tmp/tmplsidlzey/files/0/2/2/dataset_022b89c2-5b48-48f1-90df-9f41639eeeef.dat' ./solv_ions.gro && ln -s '/tmp/tmplsidlzey/files/2/3/8/dataset_238435e3-98d4-4845-b776-5077dc5bba2b.dat' ./top_input.top &&  gmx grompp -f ./minim.mdp -c ./solv_ions.gro -r ./solv_ions.gro -p ./top_input.top -o em.tpr -maxwarn '0' &>> verbose.txt && gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm em &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log false
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mdp {"__current_case__": 1, "coulombtype": "PME", "cutoffscheme": "Verlet", "emstep": "0.01", "emtol": "1000.0", "integrator": "steep", "md_steps": "50000", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "seed": "1"}
              mxw "0"
      • Step 26: param_value_from_file:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "integer"
              remove_newlines true
          • Job 2:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "integer"
              remove_newlines true
      • Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/add_line_to_file/add_line_to_file/0.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/e/0/7/dataset_e07715bf-259f-43af-967b-a105df885800.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/46/outputs/dataset_6bfbe1e9-5d24-4493-99b0-ebcd124550a8.dat' && echo 'nsteps = 100' >> '/tmp/tmplsidlzey/job_working_directory/000/46/outputs/dataset_6bfbe1e9-5d24-4493-99b0-ebcd124550a8.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              options "footer"
              text_input "nsteps = 100"
      • Step 28: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_makendx/gmx_makendx/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/files/7/2/8/dataset_728abb89-ae1a-4b10-ad6d-df343f81e38c.dat' ./input.gro && (echo '13 & ! a H*'; echo 'q') | gmx make_ndx -f ./input.gro -o ./ndx.ndx &>> verbose.txt && cp ./ndx.ndx '/tmp/tmplsidlzey/job_working_directory/000/56/outputs/dataset_8da3ca6a-820d-4d5c-8239-02ee64432315.dat'

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log false
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              sel "13 & ! a H*"
      • Step 29: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_sim/gmx_sim/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/job_working_directory/000/57/configs/tmpk4y6g2g9' ./md.mdp &&  ln -s '/tmp/tmplsidlzey/files/7/2/8/dataset_728abb89-ae1a-4b10-ad6d-df343f81e38c.dat' ./inp.gro && ln -s '/tmp/tmplsidlzey/files/2/3/8/dataset_238435e3-98d4-4845-b776-5077dc5bba2b.dat' ./top_input.top &&  ln -s '/tmp/tmplsidlzey/files/2/4/8/dataset_248c4ac7-27b8-43ed-949a-777990f70007.dat' ./posres.itp &&    gmx grompp -f ./md.mdp -c ./inp.gro -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log true
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": null, "itp_in": {"values": [{"id": 76, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/job_working_directory/000/58/configs/tmptksxkkm1' ./md.mdp &&  ln -s '/tmp/tmplsidlzey/files/7/2/8/dataset_728abb89-ae1a-4b10-ad6d-df343f81e38c.dat' ./inp.gro && ln -s '/tmp/tmplsidlzey/files/2/3/8/dataset_238435e3-98d4-4845-b776-5077dc5bba2b.dat' ./top_input.top &&  ln -s '/tmp/tmplsidlzey/files/2/4/8/dataset_248c4ac7-27b8-43ed-949a-777990f70007.dat' ./posres.itp &&    gmx grompp -f ./md.mdp -c ./inp.gro -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 0, "__job_resource__select": "no"}
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log true
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": null, "itp_in": {"values": [{"id": 76, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
      • Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/add_line_to_file/add_line_to_file/0.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/6/b/f/dataset_6bfbe1e9-5d24-4493-99b0-ebcd124550a8.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/47/outputs/dataset_56da2f4c-4dab-400d-99b9-17d71686ba6d.dat' && echo 'dt = 0.001' >> '/tmp/tmplsidlzey/job_working_directory/000/47/outputs/dataset_56da2f4c-4dab-400d-99b9-17d71686ba6d.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              options "footer"
              text_input "dt = 0.001"
      • Step 4: Salt concentration:

        • step_state: scheduled
      • Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • sed --sandbox -r -f '/tmp/tmplsidlzey/job_working_directory/000/59/configs/tmp_0lh7oyc' '/tmp/tmplsidlzey/files/8/d/a/dataset_8da3ca6a-820d-4d5c-8239-02ee64432315.dat' > '/tmp/tmplsidlzey/job_working_directory/000/59/outputs/dataset_b72d822c-4e61-4936-a288-be951e742c2f.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "ndx"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              adv_opts {"__current_case__": 0, "adv_opts_selector": "basic"}
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              code "s/System/pullgrp/;t;d"
              dbkey "?"
      • Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/add_line_to_file/add_line_to_file/0.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/5/6/d/dataset_56da2f4c-4dab-400d-99b9-17d71686ba6d.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/48/outputs/dataset_9862c624-4756-4ed7-8134-630b651e3dd4.dat' && echo ' pull-group1-pbcatom = 606' >> '/tmp/tmplsidlzey/job_working_directory/000/48/outputs/dataset_9862c624-4756-4ed7-8134-630b651e3dd4.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              options "footer"
              text_input " pull-group1-pbcatom = 606"
      • Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/add_line_to_file/add_line_to_file/0.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/b/7/2/dataset_b72d822c-4e61-4936-a288-be951e742c2f.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/60/outputs/dataset_72643c2a-860c-4426-8258-601922342efc.dat' && echo '350 364 378 606 623 658 669 683 721 2164 2184 2203 2217 2224 2235 2543 2558 2585 2841 2853 2877 2894' >> '/tmp/tmplsidlzey/job_working_directory/000/60/outputs/dataset_72643c2a-860c-4426-8258-601922342efc.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "ndx"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              options "footer"
              text_input "350 364 378 606 623 658 669 683 721 2164 2184 2203 2217 2224 2235 2543 2558 2585 2841 2853 2877 2894"
      • Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cat '/tmp/tmplsidlzey/files/8/d/a/dataset_8da3ca6a-820d-4d5c-8239-02ee64432315.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/61/outputs/dataset_213161a5-a875-48b4-a200-917021b425b8.dat' && cat '/tmp/tmplsidlzey/files/7/2/6/dataset_72643c2a-860c-4426-8258-601922342efc.dat' >> '/tmp/tmplsidlzey/job_working_directory/000/61/outputs/dataset_213161a5-a875-48b4-a200-917021b425b8.dat' && exit 0

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "ndx"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              queries [{"__index__": 0, "inputs2": {"values": [{"id": 113, "src": "hda"}]}}]
      • Step 35: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_sim/gmx_sim/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/files/9/8/6/dataset_9862c624-4756-4ed7-8134-630b651e3dd4.dat' ./md.mdp &&  ln -s '/tmp/tmplsidlzey/files/c/c/1/dataset_cc16e37f-87f4-4fe1-a771-a190b452d68f.dat' ./inp.gro && ln -s '/tmp/tmplsidlzey/files/2/3/8/dataset_238435e3-98d4-4845-b776-5077dc5bba2b.dat' ./top_input.top &&   ln -s '/tmp/tmplsidlzey/files/a/6/4/dataset_a6437388-97d3-4821-8bb0-a8a1ffe32908.dat' ./inp.cpt &&  ln -s '/tmp/tmplsidlzey/files/2/1/3/dataset_213161a5-a875-48b4-a200-917021b425b8.dat' ./index.ndx &&  gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -n ./index.ndx -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log true
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 22, "src": "dce"}]}, "itp_in": null, "ndx_in": {"values": [{"id": 114, "src": "hda"}]}}
              mxw "0"
              outps {"cpt_out": "false", "edr_out": "false", "str": "gro", "tpr_out": "true", "traj": "xtc", "xvg_out": "true"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 0, "mdp_input": {"values": [{"id": 89, "src": "hda"}]}, "mdpfile": "custom"}}
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmplsidlzey/files/9/8/6/dataset_9862c624-4756-4ed7-8134-630b651e3dd4.dat' ./md.mdp &&  ln -s '/tmp/tmplsidlzey/files/e/6/f/dataset_e6fe2165-10f7-4045-b0c9-de7d51a37b07.dat' ./inp.gro && ln -s '/tmp/tmplsidlzey/files/2/3/8/dataset_238435e3-98d4-4845-b776-5077dc5bba2b.dat' ./top_input.top &&   ln -s '/tmp/tmplsidlzey/files/2/f/8/dataset_2f86e936-1a48-4801-9565-078050155c39.dat' ./inp.cpt &&  ln -s '/tmp/tmplsidlzey/files/2/1/3/dataset_213161a5-a875-48b4-a200-917021b425b8.dat' ./index.ndx &&  gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -n ./index.ndx -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              capture_log true
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 23, "src": "dce"}]}, "itp_in": null, "ndx_in": {"values": [{"id": 114, "src": "hda"}]}}
              mxw "0"
              outps {"cpt_out": "false", "edr_out": "false", "str": "gro", "tpr_out": "true", "traj": "xtc", "xvg_out": "true"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 0, "mdp_input": {"values": [{"id": 89, "src": "hda"}]}, "mdpfile": "custom"}}
      • Step 36: toolshed.g2.bx.psu.edu/repos/chemteam/biomd_neqgamma/biomd_neqgamma/0.1.5.2+galaxy1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • echo /tmp/tmplsidlzey/files/9/f/a/dataset_9fa7026f-e842-400a-9a71-2df017a88607.dat &>> ./xvgs.txt && echo /tmp/tmplsidlzey/files/1/8/c/dataset_18c1f6db-e7b5-4867-a0b7-516f68f9dd2b.dat &>> ./xvgs.txt &&  python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/biomd_neqgamma/afcb925def69/biomd_neqgamma/NEQGamma.py' -i ./xvgs.txt -o outp.txt -ofrict ofrict.txt -vel '0.001' -T '300.0' -av '1' -sigma '1'

            Exit Code:

            • 0

            Standard Output:

            • reading data...
              reading file /tmp/tmplsidlzey/files/9/f/a/dataset_9fa7026f-e842-400a-9a71-2df017a88607.dat
              reading file /tmp/tmplsidlzey/files/1/8/c/dataset_18c1f6db-e7b5-4867-a0b7-516f68f9dd2b.dat
              calculating fluctuations...
              averaging and integrating...
              Trajectory  1 0.0 % done
              Trajectory  2 0.0 % done
              final average...
              calculating and processing ACF...
              applying Gauss filter...
              applying sliding window average...
              writing output...
              Done!
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              T "300.0"
              __input_ext "xvg"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              av "1"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              json None
              sigma "1"
              vel "0.001"
              xvgs {"values": [{"id": 14, "src": "hdca"}]}
      • Step 5: Water model:

        • step_state: scheduled
      • Step 6: Force field:

        • step_state: scheduled
      • Step 7: Number of simulations:

        • step_state: scheduled
      • Step 8: Temperature:

        • step_state: scheduled
      • Step 9: Number of equilibration steps:

        • step_state: scheduled
      • Step 10: toolshed.g2.bx.psu.edu/repos/bgruening/get_online_data/ctb_online_data_fetch/0.4:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/get_online_data/2538366eb8fb/get_online_data/get_online_data.py' --url 'https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/computational-chemistry/gromacs-dctmd/tmd.mdp' --out '/tmp/tmplsidlzey/job_working_directory/000/32/outputs/dataset_f4b0af2c-dcbf-45b4-b85d-2f149c2c07ee.dat' --whitelist 'mdp'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "data"
              __workflow_invocation_uuid__ "519d38d47a0711efb46553e5001e451b"
              chromInfo "/tmp/tmplsidlzey/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              url_paste "https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/computational-chemistry/gromacs-dctmd/tmd.mdp"
              whitelist "mdp"
    • Other invocation details
      • history_id

        • bb128d1dbce0aa62
      • history_state

        • ok
      • invocation_id

        • bb128d1dbce0aa62
      • invocation_state

        • scheduled
      • workflow_id

        • f083d6c480051025

@lldelisle

Copy link
Copy Markdown
Contributor
  • ❌ gromacs-mmgbsa.ga_0

    Problems:

    • Output with path /tmp/tmpl83pl213/MMGBSA statistics__0cfa4446-201b-43b2-a576-74b4bcce41a2 different than expected
      Expected text 'Generalized Born ESURF calculated using LCPO' in output ('| Run on Mon Sep 23 19:43:28 2024
      |
      |Input file:
      |--------------------------------------------------------------
      |# Template for mmpbsa in Galaxy
      |#  
      |&general
      |startframe=1, endframe=9999999, interval=10,
      |verbose=2, keep_files=1, strip_mask=:NA,CL,SOL, use_sander=0, entropy=0, netcdf=1
      |/
      |&gb
      |igb=5, saltcon=0.1, surfoff=0.0, molsurf=0, probe=1.4, msoffset=0.0
      |/
      |--------------------------------------------------------------
      |MMPBSA.py Version=14.0
      |Solvated complex topology file:  /tmp/tmpvxhkn1_0/files/e/3/1/dataset_e3198fbf-d15b-4624-922f-6a376f40b3a1.dat
      |Complex topology file:           /tmp/tmpvxhkn1_0/files/d/1/8/dataset_d181a42b-67e3-4266-8390-bededcec1ba7.dat
      |Receptor topology file:          /tmp/tmpvxhkn1_0/files/d/a/0/dataset_da0704c0-fc06-4722-89de-e6be266f811c.dat
      |Ligand topology file:            /tmp/tmpvxhkn1_0/files/4/b/d/dataset_4bd0fd6e-4743-4cc5-89c7-d2dd35bae1e9.dat
      |Initial mdcrd(s):                /tmp/tmpvxhkn1_0/files/3/5/9/dataset_35909988-4a9c-4139-8fcb-75ceedad75aa.dat
      |
      |Receptor mask:                  ":1-304"
      |Ligand mask:                    ":305"
      |Ligand residue name is "UNL"
      |
      |Calculations performed using 1.0 complex frames.
      |
      |Generalized Born ESURF calculated using 'LCPO' surface areas
      |
      |All units are reported in kcal/mole.
      -------------------------------------------------------------------------------
      -------------------------------------------------------------------------------
      
      GENERALIZED BORN:
      
      Complex:
      Energy Component            Average              Std. Dev.   Std. Err. of Mean
      -------------------------------------------------------------------------------
      BOND                       569.1264                0.0000              0.0000
      ANGLE                     1396.0765                0.0000              0.0000
      DIHED                     2929.2810                0.0000              0.0000
      VDWAALS                  -2512.0805                0.0000              0.0000
      EEL                     -21351.3608                0.0000              0.0000
      1-4 VDW                   1063.0823                0.0000              0.0000
      1-4 EEL                  11908.4497                0.0000              0.0000
      EGB                      -2575.4945                0.0000              0.0000
      ESURF                       99.0012                0.0000              0.0000
      
      G gas                    -5997.4254                0.0000              0.0000
      G solv                   -2476.4933                0.0000              0.0000
      
      TOTAL                    -8473.9187                0.0000              0.0000
      
      
      Receptor:
      Energy Component            Average              Std. Dev.   Std. Err. of Mean
      -------------------------------------------------------------------------------
      BOND                       459.5141                0.0000              0.0000
      ANGLE                     1175.1665                0.0000              0.0000
      DIHED                     2884.9671                0.0000              0.0000
      VDWAALS                  -2486.9721                0.0000              0.0000
      EEL                     -21525.6824                0.0000              0.0000
      1-4 VDW                   1007.9978                0.0000              0.0000
      1-4 EEL                  12139.6358                0.0000              0.0000
      EGB                      -2452.9654                0.0000              0.0000
      ESURF                       98.5225                0.0000              0.0000
      
      G gas                    -6345.3732                0.0000              0.0000
      G solv                   -2354.4429                0.0000              0.0000
      
      TOTAL                    -8699.8161                0.0000              0.0000
      
      
      Ligand:
      Energy Component            Average              Std. Dev.   Std. Err. of Mean
      -------------------------------------------------------------------------------
      BOND                       109.6123                0.0000              0.0000
      ANGLE                      220.9100                0.0000              0.0000
      DIHED                       44.3139                0.0000              0.0000
      VDWAALS                     -2.4047                0.0000              0.0000
      EEL                        107.6387                0.0000              0.0000
      1-4 VDW                     55.0845                0.0000              0.0000
      1-4 EEL                   -231.1861                0.0000              0.0000
      EGB                        -86.7998                0.0000              0.0000
      ESURF                        3.2800                0.0000              0.0000
      
      G gas                      303.9686                0.0000              0.0000
      G solv                     -83.5198                0.0000              0.0000
      
      TOTAL                      220.4488                0.0000              0.0000
      
      
      Differences (Complex - Receptor - Ligand):
      Energy Component            Average              Std. Dev.   Std. Err. of Mean
      -------------------------------------------------------------------------------
      BOND                         0.0000                0.0000              0.0000
      ANGLE                       -0.0000                0.0000              0.0000
      DIHED                        0.0000                0.0000              0.0000
      VDWAALS                    -22.7037                0.0000              0.0000
      EEL                         66.6829                0.0000              0.0000
      1-4 VDW                      0.0000                0.0000              0.0000
      1-4 EEL                     -0.0000                0.0000              0.0000
      EGB                        -35.7293                0.0000              0.0000
      ESURF                       -2.8013                0.0000              0.0000
      
      DELTA G gas                 43.9792                0.0000              0.0000
      DELTA G solv               -38.5306                0.0000              0.0000
      
      DELTA TOTAL                  5.4486                0.0000              0.0000
      
      
      -------------------------------------------------------------------------------
      -------------------------------------------------------------------------------
      ')
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: Salt concentration:

        • step_state: scheduled
      • Step 2: Number of simulations:

        • step_state: scheduled
      • Step 11: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              components [{"__index__": 0, "param_type": {"__current_case__": 2, "component_value": "0.1", "select_param_type": "float"}}]
              dbkey "?"
      • Step 12: Unlabelled step:

        • step_state: scheduled

        • Subworkflow Steps
          • Step 1: Ligand SDF:

            • step_state: scheduled
          • Step 2: pH:

            • step_state: scheduled
          • Step 11: param_value_from_file:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • cd ../; python _evaluate_expression_.py

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  param_type "integer"
                  remove_newlines true
          • Step 12: toolshed.g2.bx.psu.edu/repos/chemteam/ambertools_antechamber/ambertools_antechamber/21.10+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • antechamber -i '/tmp/tmpvxhkn1_0/files/0/7/5/dataset_0756a765-9b07-4145-ae36-136e94073035.dat' -o '/tmp/tmpvxhkn1_0/job_working_directory/000/14/outputs/dataset_37704867-9c81-462f-a822-13c2c4e7a718.dat' -fi 'pdb' -fo 'mol2' -c 'bcc' -pf 'yes' -nc '-1' -at 'gaff' -j '4' -rn 'UNL' -m '1'

                Exit Code:

                • 0

                Standard Error:

                • sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  /bin/bash: /usr/local/lib/libtinfo.so.6: no version information available (required by /bin/bash)
                  sh: /usr/local/lib/libtinfo.so.6: no version information available (required by sh)
                  

                Standard Output:

                • Welcome to antechamber 21.0: molecular input file processor.
                  
                  acdoctor mode is on: check and diagnose problems in the input file.
                  The atom type is set to gaff; the options available to the -at flag are
                      gaff, gaff2, amber, bcc, and sybyl.
                  -- Check Format for pdb File --
                     Status: pass
                  -- Check Unusual Elements --
                     Status: pass
                  -- Check Open Valences --
                  Warning: This molecule has no hydrogens nor halogens.
                           It is quite possible that there are unfilled valences.
                  -- Check Geometry --
                        for those bonded   
                        for those not bonded   
                     Status: pass
                  -- Check Weird Bonds --
                     Status: pass
                  -- Check Number of Units --
                     Status: pass
                  acdoctor mode has completed checking the input file.
                  
                  Warning: The assigned bond types may be wrong, please :
                  (1) double check the structure (the connectivity) and/or 
                  (2) adjust atom valence penalty parameters in APS.DAT, and/or 
                  (3) increase PSCUTOFF in define.h and recompile bondtype.c
                      (be cautious, using a large value of PSCUTOFF (>100) will 
                      significantly increase the computation time).
                  Info: Total number of electrons: 136; net charge: -1
                  
                  Running: /usr/local/bin/sqm -O -i sqm.in -o sqm.out
                  
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pdb"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  allparams {"at": "gaff", "c": "bcc", "j": "4", "m": "1", "nc": "-1", "resname": "UNL"}
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  extraparams {"pf": true, "usenc": true}
                  selected_output_format "mol2"
          • Step 13: toolshed.g2.bx.psu.edu/repos/chemteam/ambertools_acpype/ambertools_acpype/21.10+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • ln -s '/tmp/tmpvxhkn1_0/files/3/7/7/dataset_37704867-9c81-462f-a822-13c2c4e7a718.dat' ./input1.mol2 && acpype -i './input1.mol2' -n '-1' -b base -m '1' -a 'gaff' -c 'user' -o gmx

                Exit Code:

                • 0

                Standard Output:

                • ========================================================================================
                  | ACPYPE: AnteChamber PYthon Parser interfacE v. 2021-02-05T22:15:50CET (c) 2024 AWSdS |
                  ========================================================================================
                  ==> Reading user's charges from mol2 file...
                  ==> ... charge set to -1
                  ==> Executing Antechamber...
                  ==> * Antechamber OK *
                  ==> * Parmchk OK *
                  ==> Executing Tleap...
                  ++++++++++start_quote+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
                  Checking 'UNL'....
                  
                  /usr/local/bin/teLeap: Warning!
                  The unperturbed charge of the unit (-1.001000) is not zero.
                  Checking parameters for unit 'UNL'.
                  Checking for bond parameters.
                  Checking for angle parameters.
                  check: Warnings: 1
                  Unit is OK.
                  ++++++++++end_quote+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
                  ==> * Tleap OK *
                  ==> Removing temporary files...
                  ==> Writing GROMACS files
                  
                  ==> Writing GMX dihedrals for GMX 4.5 and higher.
                  
                  ==> Writing pickle file base.pkl
                  Total time of execution: less than a second
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "mol2"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  atomtype "gaff"
                  charge "-1"
                  charge_method "user"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  multiplicity "1"
                  save_gro true
          • Step 14: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_merge_topology_files/gmx_merge_topology_files/3.4.3+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/gmx_merge_topology_files/bc31d02be922/gmx_merge_topology_files/merge_top.py' --lig-top /tmp/tmpvxhkn1_0/files/d/e/1/dataset_de19d0e7-8617-458e-9aea-b4f9dc844d5c.dat --prot-top /tmp/tmpvxhkn1_0/files/6/3/a/dataset_63ac0968-fc42-44a9-b5d3-5573c6780d86.dat --lig-gro /tmp/tmpvxhkn1_0/files/d/d/2/dataset_dd264ef1-aa7f-48ce-b8d9-019944813fae.dat --prot-gro /tmp/tmpvxhkn1_0/files/5/5/b/dataset_55b7753d-8478-40a4-948f-0cc40548b16a.dat --complex-top complex.top --complex-gro complex.gro

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "top"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
          • Step 3: Apoprotein PDB:

            • step_state: scheduled
          • Step 4: Water model:

            • step_state: scheduled
          • Step 5: Force field:

            • step_state: scheduled
          • Step 6: toolshed.g2.bx.psu.edu/repos/bgruening/ctb_rdkit_descriptors/ctb_rdkit_descriptors/2020.03.4+galaxy1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/ctb_rdkit_descriptors/0993ac4f4a23/ctb_rdkit_descriptors/rdkit_descriptors.py' -i '/tmp/tmpvxhkn1_0/files/d/0/e/dataset_d0e2defd-d903-4f84-aee6-f4c2ac67ee4d.dat' --iformat 'sdf' -o '/tmp/tmpvxhkn1_0/job_working_directory/000/4/outputs/dataset_f85a69e2-bf8d-4971-bbc6-0c0196dee1ae.dat' -s 'FormalCharge'

                Exit Code:

                • 0

                Standard Error:

                • [19:37:29] ERROR: End of data field name not found
                  [19:37:29] ERROR: moving to the beginning of the next molecule
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "sdf"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  header false
                  select_multiple ["FormalCharge"]
          • Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/openbabel_compound_convert/openbabel_compound_convert/3.1.1+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • obabel -i 'sdf'  '/tmp/tmpvxhkn1_0/files/d/0/e/dataset_d0e2defd-d903-4f84-aee6-f4c2ac67ee4d.dat' -o 'pdb' -O '/tmp/tmpvxhkn1_0/job_working_directory/000/5/outputs/dataset_0e996f10-6fdd-4299-bafc-772a68f6de7e.dat' -e

                Exit Code:

                • 0

                Standard Error:

                • 1 molecule converted
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "sdf"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  appendtotitle ""
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dative_bonds false
                  dbkey "?"
                  oformat {"__current_case__": 51, "oformat_opts_selector": "pdb"}
                  ph "-1.0"
                  remove_h false
                  split false
                  unique {"__current_case__": 0, "unique_opts_selector": ""}
          • Step 8: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_setup/gmx_setup/2022+galaxy0:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • ln -s '/tmp/tmpvxhkn1_0/files/8/5/5/dataset_85530189-9fcd-4dd5-88ba-a99af3d988dc.dat' ./pdb_input.pdb && gmx pdb2gmx -f ./pdb_input.pdb -o processed.gro -p topol.top -i posres.itp -water tip3p -ff amber99sb -noignh -merge all &>> verbose.txt

                Exit Code:

                • 0

                Standard Output:

                • WARNING: No ICDs were found. Either,
                  - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
                  - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
                  

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pqr"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  capture_log true
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  dbkey "?"
                  ff "amber99sb"
                  ignore_h false
                  water "tip3p"
          • Step 9: Cut1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • perl '/tmp/tmpvxhkn1_0/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpvxhkn1_0/files/f/8/5/dataset_f85a69e2-bf8d-4971-bbc6-0c0196dee1ae.dat' 'c2' T '/tmp/tmpvxhkn1_0/job_working_directory/000/7/outputs/dataset_f10e50d4-9303-4713-85cb-d89a51ece808.dat'

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "tabular"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  columnList "c2"
                  dbkey "?"
                  delimiter "T"
          • Step 10: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1:

            • step_state: scheduled

            • Jobs
              • Job 1:

                • Job state is ok

                Command Line:

                • grep -P -A 0 -B 0  -i -- "HETATM" '/tmp/tmpvxhkn1_0/files/0/e/9/dataset_0e996f10-6fdd-4299-bafc-772a68f6de7e.dat' | grep -v "^--$" > "/tmp/tmpvxhkn1_0/job_working_directory/000/8/outputs/dataset_0756a765-9b07-4145-ae36-136e94073035.dat"

                Exit Code:

                • 0

                Traceback:

                Job Parameters:

                • Job parameter Parameter value
                  __input_ext "pdb"
                  __workflow_invocation_uuid__ "1641079579e311ef828de1d8d6c74011"
                  case_sensitive "-i"
                  chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                  color "NOCOLOR"
                  dbkey "?"
                  invert ""
                  lines_after "0"
                  lines_before "0"
                  regex_type "-P"
                  url_paste "HETATM"
      • Step 13: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/1.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • times=2; yes -- "0.1" 2>/dev/null | head -n $times >> /tmp/tmpvxhkn1_0/job_working_directory/000/10/outputs/dataset_de68d731-fe7b-4b90-a5fe-56c95dbc4a2a.dat;

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "data"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              token_set [{"__index__": 0, "line": "0.1", "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "2"}}]
      • Step 14: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_editconf/gmx_editconf/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/files/1/2/3/dataset_1232be0e-1f12-48e1-80d0-6e4ed2fd827d.dat' ./input.gro && gmx editconf -f ./input.gro -o ./output.gro -d 1.0 -bt triclinic &>> verbose.txt &&  cp ./output.gro '/tmp/tmpvxhkn1_0/job_working_directory/000/17/outputs/dataset_7c98bf53-42f0-4061-bae9-4606addbb485.dat'

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              box {"__current_case__": 0, "config": "true", "dim": "1.0", "type": "triclinic"}
              capture_log false
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              output_format "gro"
      • Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir ./out && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/baabc30154cd/split_file_to_collection/split_file_to_collection.py' --out ./out --in '/tmp/tmpvxhkn1_0/files/d/e/6/dataset_de68d731-fe7b-4b90-a5fe-56c95dbc4a2a.dat' --ftype 'txt' --chunksize 1 --file_names 'split_file' --file_ext 'txt'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              split_parms {"__current_case__": 5, "input": {"values": [{"id": 13, "src": "hda"}]}, "newfilenames": "split_file", "select_allocate": {"__current_case__": 2, "allocate": "byrow"}, "select_ftype": "txt", "select_mode": {"__current_case__": 0, "chunksize": "1", "mode": "chunk"}}
      • Step 16: param_value_from_file:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "float"
              remove_newlines true
          • Job 2:

            • Job state is ok

            Command Line:

            • cd ../; python _evaluate_expression_.py

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_type "float"
              remove_newlines true
      • Step 17: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_solvate/gmx_solvate/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/18/configs/tmp3uygh3lv' ./ions.mdp && ln -s '/tmp/tmpvxhkn1_0/files/7/c/9/dataset_7c98bf53-42f0-4061-bae9-4606addbb485.dat' ./gro_input.gro && ln -s '/tmp/tmpvxhkn1_0/files/8/4/0/dataset_840d11ea-5ba9-4099-b366-3f32fde7232c.dat' ./top_input.top &&  gmx solvate -cp ./gro_input.gro -cs spc216.gro -o solv.gro -p ./top_input.top &>> verbose.txt && gmx grompp -f ./ions.mdp -c solv.gro -p ./top_input.top -o ions.tpr -maxwarn '0' &>> verbose.txt && echo 'SOL' | gmx genion -s ions.tpr -o solv_ions.gro -p ./top_input.top -pname NA -nname CL -neutral -conc 0.1 -seed 1 &>> verbose.txt && mv solv_ions.gro solv.gro

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log false
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              conc "0.1"
              dbkey "?"
              mxw "0"
              neutralise "-neutral"
              seed "1"
              water_model "spc216"
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/19/configs/tmpcpwh8evl' ./ions.mdp && ln -s '/tmp/tmpvxhkn1_0/files/7/c/9/dataset_7c98bf53-42f0-4061-bae9-4606addbb485.dat' ./gro_input.gro && ln -s '/tmp/tmpvxhkn1_0/files/8/4/0/dataset_840d11ea-5ba9-4099-b366-3f32fde7232c.dat' ./top_input.top &&  gmx solvate -cp ./gro_input.gro -cs spc216.gro -o solv.gro -p ./top_input.top &>> verbose.txt && gmx grompp -f ./ions.mdp -c solv.gro -p ./top_input.top -o ions.tpr -maxwarn '0' &>> verbose.txt && echo 'SOL' | gmx genion -s ions.tpr -o solv_ions.gro -p ./top_input.top -pname NA -nname CL -neutral -conc 0.1 -seed 1 &>> verbose.txt && mv solv_ions.gro solv.gro

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log false
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              conc "0.1"
              dbkey "?"
              mxw "0"
              neutralise "-neutral"
              seed "1"
              water_model "spc216"
      • Step 18: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_em/gmx_em/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/20/configs/tmpynxs2y76' ./minim.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/0/e/0/dataset_0e013beb-239e-4ad5-a157-69012d688d8e.dat' ./solv_ions.gro && ln -s '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' ./top_input.top &&  gmx grompp -f ./minim.mdp -c ./solv_ions.gro -r ./solv_ions.gro -p ./top_input.top -o em.tpr -maxwarn '0' &>> verbose.txt && gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm em &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mdp {"__current_case__": 1, "coulombtype": "PME", "cutoffscheme": "Verlet", "emstep": "0.01", "emtol": "1000.0", "integrator": "steep", "md_steps": "50000", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "seed": "1"}
              mxw "0"
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/21/configs/tmpnabbuve8' ./minim.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/b/e/3/dataset_be3642a2-6852-44e8-bf13-f27cde804ba4.dat' ./solv_ions.gro && ln -s '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' ./top_input.top &&  gmx grompp -f ./minim.mdp -c ./solv_ions.gro -r ./solv_ions.gro -p ./top_input.top -o em.tpr -maxwarn '0' &>> verbose.txt && gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm em &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              mdp {"__current_case__": 1, "coulombtype": "PME", "cutoffscheme": "Verlet", "emstep": "0.01", "emtol": "1000.0", "integrator": "steep", "md_steps": "50000", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "seed": "1"}
              mxw "0"
      • Step 19: toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/parmconv/21.10+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/0/e/0/dataset_0e013beb-239e-4ad5-a157-69012d688d8e.dat' --itop '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' --removedihe --removebox --iradii 'mbondi' --istripmask '!:UNL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/22/outputs/dataset_4bd0fd6e-4743-4cc5-89c7-d2dd35bae1e9.dat' 2>&1  && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/0/e/0/dataset_0e013beb-239e-4ad5-a157-69012d688d8e.dat' --itop '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' --removedihe --removebox --iradii 'mbondi' --istripmask ':NA,CL,SOL,UNL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/22/outputs/dataset_da0704c0-fc06-4722-89de-e6be266f811c.dat' 2>&1 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/0/e/0/dataset_0e013beb-239e-4ad5-a157-69012d688d8e.dat' --itop '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' --removedihe --removebox --iradii 'mbondi' --istripmask ':NA,CL,SOL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/22/outputs/dataset_d181a42b-67e3-4266-8390-bededcec1ba7.dat' 2>&1 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/0/e/0/dataset_0e013beb-239e-4ad5-a157-69012d688d8e.dat' --itop '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' --removedihe --removebox --iradii 'mbondi' --istripmask '' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/22/outputs/dataset_e3198fbf-d15b-4624-922f-6a376f40b3a1.dat' 2>&1

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "top"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_inputs {"__current_case__": 1, "fmt": "GROMACS", "modbehaviour": {"radii": "mbondi", "removebox": true, "removedihe": true}, "str_in": {"values": [{"id": 5, "src": "dce"}]}, "top_in": {"values": [{"id": 7, "src": "dce"}]}}
              stripmask_complex ":NA,CL,SOL"
              stripmask_ligand "!:UNL"
              stripmask_receptor ":NA,CL,SOL,UNL"
              stripmask_solvatedcomplex ""
          • Job 2:

            • Job state is ok

            Command Line:

            • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/b/e/3/dataset_be3642a2-6852-44e8-bf13-f27cde804ba4.dat' --itop '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' --removedihe --removebox --iradii 'mbondi' --istripmask '!:UNL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/23/outputs/dataset_89edcbc6-5c7a-46b8-820b-bb2909cd8872.dat' 2>&1  && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/b/e/3/dataset_be3642a2-6852-44e8-bf13-f27cde804ba4.dat' --itop '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' --removedihe --removebox --iradii 'mbondi' --istripmask ':NA,CL,SOL,UNL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/23/outputs/dataset_f603b4f5-7c98-4908-9279-4bea37516fae.dat' 2>&1 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/b/e/3/dataset_be3642a2-6852-44e8-bf13-f27cde804ba4.dat' --itop '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' --removedihe --removebox --iradii 'mbondi' --istripmask ':NA,CL,SOL' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/23/outputs/dataset_d23bedb5-883a-4c45-ad44-6ca3176dd289.dat' 2>&1 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/chemteam/parmconv/6d0677a148fe/parmconv/parmconv.py' --istr '/tmp/tmpvxhkn1_0/files/b/e/3/dataset_be3642a2-6852-44e8-bf13-f27cde804ba4.dat' --itop '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' --removedihe --removebox --iradii 'mbondi' --istripmask '' --o_prmtop '/tmp/tmpvxhkn1_0/job_working_directory/000/23/outputs/dataset_1a91dbfa-a1da-4c99-bcb2-20a1f74d3056.dat' 2>&1

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              Original number of dihedrals 13366
              Update number of dihedrals 10600
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "top"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              param_inputs {"__current_case__": 1, "fmt": "GROMACS", "modbehaviour": {"radii": "mbondi", "removebox": true, "removedihe": true}, "str_in": {"values": [{"id": 6, "src": "dce"}]}, "top_in": {"values": [{"id": 8, "src": "dce"}]}}
              stripmask_complex ":NA,CL,SOL"
              stripmask_ligand "!:UNL"
              stripmask_receptor ":NA,CL,SOL,UNL"
              stripmask_solvatedcomplex ""
      • Step 20: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_sim/gmx_sim/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/24/configs/tmpxlm88fdw' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/c/a/e/dataset_cae34e80-8ac5-4f2b-8fd9-cb0ce880266d.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' ./top_input.top &&  ln -s '/tmp/tmpvxhkn1_0/files/4/e/e/dataset_4ee4727f-2f93-43ba-927f-35ddbb36dfdb.dat' ./posres.itp &&    gmx grompp -f ./md.mdp -c ./inp.gro -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": null, "itp_in": {"values": [{"id": 8, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/25/configs/tmpz7s1hs00' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/3/a/f/dataset_3afc39bc-5153-4e5d-9698-6e176bce740f.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' ./top_input.top &&  ln -s '/tmp/tmpvxhkn1_0/files/4/e/e/dataset_4ee4727f-2f93-43ba-927f-35ddbb36dfdb.dat' ./posres.itp &&    gmx grompp -f ./md.mdp -c ./inp.gro -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": null, "itp_in": {"values": [{"id": 8, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
      • Step 3: Apoprotein PDB:

        • step_state: scheduled
      • Step 21: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_sim/gmx_sim/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/26/configs/tmpjbe3n06q' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/d/7/f/dataset_d7f48fef-f073-437f-8637-d4f44de1f958.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' ./top_input.top &&  ln -s '/tmp/tmpvxhkn1_0/files/4/e/e/dataset_4ee4727f-2f93-43ba-927f-35ddbb36dfdb.dat' ./posres.itp &&  ln -s '/tmp/tmpvxhkn1_0/files/f/f/a/dataset_ffa78526-92fe-446a-81eb-6582cba8b8fa.dat' ./inp.cpt &&   gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 27, "src": "dce"}]}, "itp_in": {"values": [{"id": 8, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/27/configs/tmp2pjh9ojl' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/8/3/d/dataset_83d8aba3-0b1f-4589-9ecc-7485a8755c54.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' ./top_input.top &&  ln -s '/tmp/tmpvxhkn1_0/files/4/e/e/dataset_4ee4727f-2f93-43ba-927f-35ddbb36dfdb.dat' ./posres.itp &&  ln -s '/tmp/tmpvxhkn1_0/files/0/6/f/dataset_06f7f054-fbec-4031-9ac8-19a560dcc545.dat' ./inp.cpt &&   gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -r ./inp.gro -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 28, "src": "dce"}]}, "itp_in": {"values": [{"id": 8, "src": "hda"}]}, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "true", "edr_out": "false", "str": "gro", "tpr_out": "false", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "h-bonds", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "50", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
      • Step 22: toolshed.g2.bx.psu.edu/repos/chemteam/gmx_sim/gmx_sim/2022+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/28/configs/tmpz1drfxq2' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/b/4/6/dataset_b465a150-1d04-40db-99e0-c331437b68a6.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/a/5/7/dataset_a578febc-cea8-46f7-a604-a2f7e7e8f0b5.dat' ./top_input.top &&   ln -s '/tmp/tmpvxhkn1_0/files/9/9/3/dataset_993eeeb2-887f-4f06-b795-bf51679df93d.dat' ./inp.cpt &&   gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 35, "src": "dce"}]}, "itp_in": null, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "false", "edr_out": "false", "str": "gro", "tpr_out": "true", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "none", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "100", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/job_working_directory/000/29/configs/tmpq2012j0d' ./md.mdp &&  ln -s '/tmp/tmpvxhkn1_0/files/d/c/8/dataset_dc8275b8-b93b-4559-97bb-c48e01d1f26f.dat' ./inp.gro && ln -s '/tmp/tmpvxhkn1_0/files/d/9/6/dataset_d964cb5f-5986-4325-8d69-b74d9161a99d.dat' ./top_input.top &&   ln -s '/tmp/tmpvxhkn1_0/files/1/6/4/dataset_164e9f05-9f67-4193-a61a-cd7cdd73eade.dat' ./inp.cpt &&   gmx grompp -f ./md.mdp -c ./inp.gro -t ./inp.cpt -p ./top_input.top -o outp.tpr -maxwarn '0' &>> verbose.txt &&  gmx mdrun -nt "${GALAXY_SLOTS:-4}" -deffnm outp &>> verbose.txt   && cat md.mdp &>> verbose.txt

            Exit Code:

            • 0

            Standard Output:

            • WARNING: No ICDs were found. Either,
              - Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or 
              - Make your system-wide implementation visible by installing ocl-icd-system conda package. 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "gro"
              __job_resource {"__current_case__": 1, "__job_resource__select": "yes", "gpu": "1"}
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              capture_log true
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              inps {"cpt_in": {"values": [{"id": 36, "src": "dce"}]}, "itp_in": null, "ndx_in": null}
              mxw "0"
              outps {"cpt_out": "false", "edr_out": "false", "str": "gro", "tpr_out": "true", "traj": "xtc", "xvg_out": "false"}
              sets {"ensembleselect": {"__current_case__": 0, "ensemble": "nvt", "startvel": "false"}, "mdp": {"__current_case__": 1, "constraints": "none", "coulombtype": "PME", "cutoffscheme": "Verlet", "integrator": "md", "md_steps": "100", "mdpfile": "default", "rcoulomb": "1.0", "rlist": "1.0", "rvdw": "1.0", "step_length": "0.001", "systemTcouple": "false", "temperature": "300", "write_freq": "1000"}}
      • Step 23: toolshed.g2.bx.psu.edu/repos/chemteam/md_converter/md_converter/1.9.6+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/files/9/9/2/dataset_992ec290-da3d-4317-8841-52bf8d578482.dat' ./input.xtc && mdconvert ./input.xtc -o ./output.netcdf && cp ./output.netcdf /tmp/tmpvxhkn1_0/job_working_directory/000/30/outputs/dataset_35909988-4a9c-4139-8fcb-75ceedad75aa.dat

            Exit Code:

            • 0

            Standard Error:

            • Warning: 'step' data from input file(s) will be discarded. output format only supports fields: 'xyz', 'time', 'cell_lengths', 'cell_angles'
              

            Standard Output:

            • converted 1 frames, 37834 atoms 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "xtc"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              output_format "netcdf"
          • Job 2:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpvxhkn1_0/files/8/0/3/dataset_8036522c-dd7d-423d-8665-dd6dcce8d565.dat' ./input.xtc && mdconvert ./input.xtc -o ./output.netcdf && cp ./output.netcdf /tmp/tmpvxhkn1_0/job_working_directory/000/31/outputs/dataset_e22d420e-8f84-4a80-9d73-f79b8f90c140.dat

            Exit Code:

            • 0

            Standard Error:

            • Warning: 'step' data from input file(s) will be discarded. output format only supports fields: 'xyz', 'time', 'cell_lengths', 'cell_angles'
              

            Standard Output:

            • converted 1 frames, 37834 atoms 
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "xtc"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              output_format "netcdf"
      • Step 24: toolshed.g2.bx.psu.edu/repos/chemteam/mmpbsa_mmgbsa/mmpbsa_mmgbsa/21.10+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/tmpvxhkn1_0/job_working_directory/000/32/configs/tmp6k4n6h12' '/tmp/tmpvxhkn1_0/job_working_directory/000/32/configs/tmpqx47wlr9' && PATH_TO_MMPBSA=$(dirname `which MMPBSA.py`) && export AMBERHOME=$(dirname $PATH_TO_MMPBSA) && MMPBSA.py -O -i '/tmp/tmpvxhkn1_0/job_working_directory/000/32/outputs/dataset_1c33c876-fbe6-4c02-9456-49292b9c59e3.dat' -sp '/tmp/tmpvxhkn1_0/files/e/3/1/dataset_e3198fbf-d15b-4624-922f-6a376f40b3a1.dat' -cp '/tmp/tmpvxhkn1_0/files/d/1/8/dataset_d181a42b-67e3-4266-8390-bededcec1ba7.dat' -rp '/tmp/tmpvxhkn1_0/files/d/a/0/dataset_da0704c0-fc06-4722-89de-e6be266f811c.dat' -lp '/tmp/tmpvxhkn1_0/files/4/b/d/dataset_4bd0fd6e-4743-4cc5-89c7-d2dd35bae1e9.dat' -y '/tmp/tmpvxhkn1_0/files/3/5/9/dataset_35909988-4a9c-4139-8fcb-75ceedad75aa.dat' -o '/tmp/tmpvxhkn1_0/job_working_directory/000/32/outputs/dataset_0cfa4446-201b-43b2-a576-74b4bcce41a2.dat' -do 'XXXX'

            Exit Code:

            • 0

            Standard Error:

            • /usr/local/lib/python3.9/site-packages/MMPBSA_mods/make_trajs.py:631: UserWarning: Solvated topology 0 has IFBOX == 0
                warn('Solvated topology %s has IFBOX == 0' % ifbox)
              

            Standard Output:

            • {'input': {'simulation': {'simtype': 'single'}}, 'allparams': {'startframe': 1, 'endframe': 9999999, 'interval': 10, 'entropy': False, 'use_sander': False, 'keep_files': True, 'strip_mask': ':NA,CL,SOL'}, 'calcdetails': {'gb_pb_calc': {'igb': '5', 'saltcon': 0.1, 'surfoff': 0.0, 'molsurf': False, 'probe': 1.4, 'msoffset': 0.0, 'calctype': 'gb'}, 'decomposition': {'decomposition': 'no'}}}
              Loading and checking parameter files for compatibility...
              cpptraj found! Using /usr/local/bin/cpptraj
              mmpbsa_py_energy found! Using /usr/local/bin/mmpbsa_py_energy
              Preparing trajectories for simulation...
              1 frames were processed by cpptraj for use in calculation.
              
              Running calculations on normal system...
              
              Beginning GB calculations with /usr/local/bin/mmpbsa_py_energy
                calculating complex contribution...
                calculating receptor contribution...
                calculating ligand contribution...
              
              Timing:
              Total setup time:                           0.506 sec.
              Creating trajectories with cpptraj:         1.639 sec.
              Total calculation time:                     5.942 sec.
              
              Total GB calculation time:                  5.942 sec.
              
              Statistics calculation & output writing:    0.001 sec.
              Total time taken:                           8.090 sec.
              
              
              MMPBSA.py Finished! Thank you for using. Please cite us if you publish this work with this paper:
                 Miller III, B. R., McGee Jr., T. D., Swails, J. M. Homeyer, N. Gohlke, H. and Roitberg, A. E.
                 J. Chem. Theory Comput., 2012, 8 (9) pp 3314--3321
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              allparams {"endframe": "9999999", "entropy": false, "interval": "10", "keep_files": true, "startframe": "1", "strip_mask": ":NA,CL,SOL", "use_sander": false}
              calcdetails {"decomposition": {"__current_case__": 1, "decomposition": "no"}, "gb_pb_calc": {"__current_case__": 0, "calctype": "gb", "igb": "5", "molsurf": false, "msoffset": "0.0", "probe": "1.4", "saltcon": "0.1", "surfoff": "0.0"}}
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              input {"simulation": {"__current_case__": 0, "complex": {"values": [{"id": 19, "src": "dce"}]}, "ligand": {"values": [{"id": 15, "src": "dce"}]}, "receptor": {"values": [{"id": 17, "src": "dce"}]}, "simtype": "single", "solvatedcomplex": {"values": [{"id": 21, "src": "dce"}]}, "trajcomplex": {"values": [{"id": 47, "src": "dce"}]}}}
          • Job 2:

            • Job state is ok

            Command Line:

            • python '/tmp/tmpvxhkn1_0/job_working_directory/000/33/configs/tmpar4gii3i' '/tmp/tmpvxhkn1_0/job_working_directory/000/33/configs/tmpkknbgbas' && PATH_TO_MMPBSA=$(dirname `which MMPBSA.py`) && export AMBERHOME=$(dirname $PATH_TO_MMPBSA) && MMPBSA.py -O -i '/tmp/tmpvxhkn1_0/job_working_directory/000/33/outputs/dataset_9039270c-1c47-465e-aa4d-1683f9179bf1.dat' -sp '/tmp/tmpvxhkn1_0/files/1/a/9/dataset_1a91dbfa-a1da-4c99-bcb2-20a1f74d3056.dat' -cp '/tmp/tmpvxhkn1_0/files/d/2/3/dataset_d23bedb5-883a-4c45-ad44-6ca3176dd289.dat' -rp '/tmp/tmpvxhkn1_0/files/f/6/0/dataset_f603b4f5-7c98-4908-9279-4bea37516fae.dat' -lp '/tmp/tmpvxhkn1_0/files/8/9/e/dataset_89edcbc6-5c7a-46b8-820b-bb2909cd8872.dat' -y '/tmp/tmpvxhkn1_0/files/e/2/2/dataset_e22d420e-8f84-4a80-9d73-f79b8f90c140.dat' -o '/tmp/tmpvxhkn1_0/job_working_directory/000/33/outputs/dataset_9d8a0353-0c42-489a-a036-4a3705234125.dat' -do 'XXXX'

            Exit Code:

            • 0

            Standard Error:

            • /usr/local/lib/python3.9/site-packages/MMPBSA_mods/make_trajs.py:631: UserWarning: Solvated topology 0 has IFBOX == 0
                warn('Solvated topology %s has IFBOX == 0' % ifbox)
              

            Standard Output:

            • {'input': {'simulation': {'simtype': 'single'}}, 'allparams': {'startframe': 1, 'endframe': 9999999, 'interval': 10, 'entropy': False, 'use_sander': False, 'keep_files': True, 'strip_mask': ':NA,CL,SOL'}, 'calcdetails': {'gb_pb_calc': {'igb': '5', 'saltcon': 0.1, 'surfoff': 0.0, 'molsurf': False, 'probe': 1.4, 'msoffset': 0.0, 'calctype': 'gb'}, 'decomposition': {'decomposition': 'no'}}}
              Loading and checking parameter files for compatibility...
              cpptraj found! Using /usr/local/bin/cpptraj
              mmpbsa_py_energy found! Using /usr/local/bin/mmpbsa_py_energy
              Preparing trajectories for simulation...
              1 frames were processed by cpptraj for use in calculation.
              
              Running calculations on normal system...
              
              Beginning GB calculations with /usr/local/bin/mmpbsa_py_energy
                calculating complex contribution...
                calculating receptor contribution...
                calculating ligand contribution...
              
              Timing:
              Total setup time:                           0.506 sec.
              Creating trajectories with cpptraj:         1.666 sec.
              Total calculation time:                     6.023 sec.
              
              Total GB calculation time:                  6.023 sec.
              
              Statistics calculation & output writing:    0.002 sec.
              Total time taken:                           8.200 sec.
              
              
              MMPBSA.py Finished! Thank you for using. Please cite us if you publish this work with this paper:
                 Miller III, B. R., McGee Jr., T. D., Swails, J. M. Homeyer, N. Gohlke, H. and Roitberg, A. E.
                 J. Chem. Theory Comput., 2012, 8 (9) pp 3314--3321
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              allparams {"endframe": "9999999", "entropy": false, "interval": "10", "keep_files": true, "startframe": "1", "strip_mask": ":NA,CL,SOL", "use_sander": false}
              calcdetails {"decomposition": {"__current_case__": 1, "decomposition": "no"}, "gb_pb_calc": {"__current_case__": 0, "calctype": "gb", "igb": "5", "molsurf": false, "msoffset": "0.0", "probe": "1.4", "saltcon": "0.1", "surfoff": "0.0"}}
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              input {"simulation": {"__current_case__": 0, "complex": {"values": [{"id": 20, "src": "dce"}]}, "ligand": {"values": [{"id": 16, "src": "dce"}]}, "receptor": {"values": [{"id": 18, "src": "dce"}]}, "simtype": "single", "solvatedcomplex": {"values": [{"id": 22, "src": "dce"}]}, "trajcomplex": {"values": [{"id": 48, "src": "dce"}]}}}
      • Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • grep -P -A 0 -B 0  -i -- "DELTA TOTAL" '/tmp/tmpvxhkn1_0/files/0/c/f/dataset_0cfa4446-201b-43b2-a576-74b4bcce41a2.dat' | grep -v "^--$" > "/tmp/tmpvxhkn1_0/job_working_directory/000/34/outputs/dataset_b668e188-5a8a-4dff-af89-6d49fcd4ee83.dat"

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              case_sensitive "-i"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              color "NOCOLOR"
              dbkey "?"
              invert ""
              lines_after "0"
              lines_before "0"
              regex_type "-P"
              url_paste "DELTA TOTAL"
          • Job 2:

            • Job state is ok

            Command Line:

            • grep -P -A 0 -B 0  -i -- "DELTA TOTAL" '/tmp/tmpvxhkn1_0/files/9/d/8/dataset_9d8a0353-0c42-489a-a036-4a3705234125.dat' | grep -v "^--$" > "/tmp/tmpvxhkn1_0/job_working_directory/000/35/outputs/dataset_42246ae4-3cab-4ec4-a137-56c768be6d60.dat"

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              case_sensitive "-i"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              color "NOCOLOR"
              dbkey "?"
              invert ""
              lines_after "0"
              lines_before "0"
              regex_type "-P"
              url_paste "DELTA TOTAL"
      • Step 26: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • (   cat "/tmp/tmpvxhkn1_0/files/b/6/6/dataset_b668e188-5a8a-4dff-af89-6d49fcd4ee83.dat" ;   cat "/tmp/tmpvxhkn1_0/files/4/2/2/dataset_42246ae4-3cab-4ec4-a137-56c768be6d60.dat" ;   ) > /tmp/tmpvxhkn1_0/job_working_directory/000/36/outputs/dataset_014fd9c2-21cd-4949-ba78-bde7bd8a7535.dat

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              filename {"__current_case__": 1, "add_name": false}
              one_header false
      • Step 27: Cut1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • perl '/tmp/tmpvxhkn1_0/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpvxhkn1_0/files/0/1/4/dataset_014fd9c2-21cd-4949-ba78-bde7bd8a7535.dat' 'c3' Sp '/tmp/tmpvxhkn1_0/job_working_directory/000/37/outputs/dataset_b5e2748b-d676-4502-b767-5308ad301a3e.dat'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "txt"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              columnList "c3"
              dbkey "?"
              delimiter "Sp"
      • Step 28: Summary_Statistics1:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • python '/tmp/tmpvxhkn1_0/galaxy-dev/tools/stats/gsummary.py' '/tmp/tmpvxhkn1_0/files/b/5/e/dataset_b5e2748b-d676-4502-b767-5308ad301a3e.dat' '/tmp/tmpvxhkn1_0/job_working_directory/000/38/outputs/dataset_006e9849-8d4f-4805-9529-7f5996aa382b.dat' 'c1'

            Exit Code:

            • 0

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "tabular"
              __workflow_invocation_uuid__ "1641079479e311ef828de1d8d6c74011"
              chromInfo "/tmp/tmpvxhkn1_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              cond "c1"
              dbkey "?"
      • Step 4: Water model:

        • step_state: scheduled
      • Step 5: pH:

        • step_state: scheduled
      • Step 6: Force field:

        • step_state: scheduled
      • Step 7: Ligand SDF:

        • step_state: scheduled
      • Step 8: NVT equilibration steps:

        • step_state: scheduled
      • Step 9: NPT equilibration steps:

        • step_state: scheduled
      • Step 10: Production steps:

        • step_state: scheduled
    • Other invocation details
      • history_id

        • 85bedf2a5b51efe5
      • history_state

        • ok
      • invocation_id

        • 85bedf2a5b51efe5
      • invocation_state

        • scheduled
      • workflow_id

        • bcde33e7df7b8c78

@lldelisle

Copy link
Copy Markdown
Contributor

For bacterial_genome_annotation.ga_0 the log is too long:

  • ❌ bacterial_genome_annotation.ga_0

    Problems:

    • Output with path /tmp/tmp6qz9cgl7/integronfinder2_summary__fe621a87-acf7-456e-aa03-f7bf67489890 different than expected
      Expected 6+-0 columns in output found 1
      
    • Output with path /tmp/tmpj0zpr7mq/integronfinder2_results_tabular__d8782c17-7d24-4cb6-a837-fbe389fdc90d different than expected
      Expected 14+-0 columns in output found 1
      
    • Output with path /tmp/tmpoqhx1ku0/bakta_hypothetical_tabular__2883fe13-b7f6-4872-ad63-eb860ce952f3 different than expected
      Expected 9+-0 columns in output found 1
      
    • Output with path /tmp/tmpc3yab_y5/bakta_annotation_tabular__dea11696-be38-447a-9fa1-8dd4e5205b2b different than expected
      Expected 9+-0 columns in output found 1
      
    • Output with path /tmp/tmpwu261vpa/tooldistillator_summarize__358834d3-8d48-4596-8516-318ac53f0442 different than expected
      Expected text 'insertion_sequence' in output ('[{"analysis_software_version": "1.7.2.3", "reference_database_version": null, "analysis_software_name": "isescan", "results": [{"name": "isescan_report", "file_path": "/tmp/tmpl1obw4de/files/6/3/a/dataset_63ab0ecc-ed8b-4fcd-87ef-c2873bcc36ab.dat", "hid": "4", "galaxy_id": null, "content": [{"seqID": "contig00006", "family": "IS21", "cluster": "IS21_288", "isBegin": 38191, "isEnd": 42495, "isLen": 4305, "ncopy4is": 1, "start1": 38191, "end1": 38217, "start2": 42469, "end2": 42495, "score": 26, "irId": 20, "irLen": 27, "nGaps": 0, "orfBegin": 38536, "orfEnd": 42164, "strand": "+", "orfLen": 3629, "E-value": 6.5e-11, "E-value4copy": 6.5e-11, "type": "p", "ov": 1, "tir": "ATCAAGAAAAATGGGGATCGTGAAGAA:ATTAAGCCAAATGGCAATGGTGATGAA"}, ....... I (Lucille) truncated the output to be able to paste it in this comment}]}], "tool_has_database": true}]')
      

    Workflow invocation details

    • Invocation Messages

    • Steps
      • Step 1: Input sequence fasta:

        • step_state: scheduled
      • Step 2: Select a plasmid detection database:

        • step_state: scheduled
      • Step 3: Select a bacterial genome annotation database:

        • step_state: scheduled
      • Step 4: Select a AMRFinderPlus database:

        • step_state: scheduled
      • Step 5: genomic_annotation_insertionelement_isescan:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • ln -s '/tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat' input && isescan.py --seqfile input --output 'results'  --nthread ${GALAXY_SLOTS:-7}  | tee '/tmp/tmpl1obw4de/job_working_directory/000/8/outputs/dataset_9f3e6ebd-8724-4818-818b-78fd9731e697.dat'

            Exit Code:

            • 0

            Standard Output:

            • /usr/local/bin/FragGeneScan -s input -o results/proteome/input -w 0 -t illumina_5 -p 1
              Using 1 threads.
              no. of seqs: 153
              Clock time used (by 1 threads) = 0.11 mins
              prepare gff file..
              Time elapsed: 0 hours 0 minutes and 8 seconds.
              ISEScan starts at Mon Sep 23 19:38:51 2024
              predict and translate genes from genome sequence into protein database using FragGeneScan program
              
              Begin to translate genome into proteome.
              Translating genome into proteome for input , return  0
              
              Finish translating genome into proteome. Mon Sep 23 19:38:59 2024
              
              Begin to phmmer search against proteome database. Mon Sep 23 19:38:59 2024
              Finish phmmer searching /usr/local/bin/pHMMs/clusters.single.faa  against results/proteome/input.faa , output results/hmm/clusters.single.faa.input.faa
              
              Finish phmmer searching against proteome database. Mon Sep 23 19:50:12 2024
              
              Begin to profile HMM search against proteome database. Mon Sep 23 19:50:12 2024
              Finish Profile HMM searching /usr/local/bin/pHMMs/clusters.faa.hmm  against results/proteome/input.faa , output results/hmm/clusters.faa.hmm.input.faa
              
              Finish profile HMM searching against proteome database. Mon Sep 23 20:00:28 2024
              pred begins at Mon Sep 23 20:00:28 2024
              Warning: no significant hit with E-value <= 1e-10 found for contig00002
              Warning: no significant hit with E-value <= 1e-10 found for contig00003
              Warning: no significant hit with E-value <= 1e-10 found for contig00004
              Warning: no significant hit with E-value <= 1e-10 found for contig00005
              Warning: no significant hit with E-value <= 1e-10 found for contig00008
              Warning: no significant hit with E-value <= 1e-10 found for contig00011
              Warning: no significant hit with E-value <= 1e-10 found for contig00012
              Warning: no significant hit with E-value <= 1e-10 found for contig00013
              Warning: no significant hit with E-value <= 1e-10 found for contig00014
              Warning: no significant hit with E-value <= 1e-10 found for contig00017
              Warning: no significant hit with E-value <= 1e-10 found for contig00020
              Warning: no significant hit with E-value <= 1e-10 found for contig00021
              Warning: no significant hit with E-value <= 1e-10 found for contig00022
              Warning: no significant hit with E-value <= 1e-10 found for contig00023
              Warning: no significant hit with E-value <= 1e-10 found for contig00024
              Warning: no significant hit with E-value <= 1e-10 found for contig00026
              Warning: no significant hit with E-value <= 1e-10 found for contig00027
              Warning: no significant hit with E-value <= 1e-10 found for contig00028
              Warning: no significant hit with E-value <= 1e-10 found for contig00030
              Warning: no significant hit with E-value <= 1e-10 found for contig00031
              Warning: no significant hit with E-value <= 1e-10 found for contig00032
              Warning: no significant hit with E-value <= 1e-10 found for contig00033
              Warning: no significant hit with E-value <= 1e-10 found for contig00034
              Warning: no significant hit with E-value <= 1e-10 found for contig00035
              Warning: no significant hit with E-value <= 1e-10 found for contig00036
              Warning: no significant hit with E-value <= 1e-10 found for contig00037
              Warning: no significant hit with E-value <= 1e-10 found for contig00040
              Warning: no significant hit with E-value <= 1e-10 found for contig00041
              Warning: no significant hit with E-value <= 1e-10 found for contig00042
              Warning: no significant hit with E-value <= 1e-10 found for contig00044
              Warning: no significant hit with E-value <= 1e-10 found for contig00045
              Warning: no significant hit with E-value <= 1e-10 found for contig00046
              Warning: no significant hit with E-value <= 1e-10 found for contig00047
              Warning: no significant hit with E-value <= 1e-10 found for contig00048
              Warning: no significant hit with E-value <= 1e-10 found for contig00050
              Warning: no significant hit with E-value <= 1e-10 found for contig00051
              Warning: no significant hit with E-value <= 1e-10 found for contig00053
              Warning: no significant hit with E-value <= 1e-10 found for contig00054
              Warning: no significant hit with E-value <= 1e-10 found for contig00055
              Warning: no significant hit with E-value <= 1e-10 found for contig00057
              Warning: no significant hit with E-value <= 1e-10 found for contig00058
              Warning: no significant hit with E-value <= 1e-10 found for contig00059
              Warning: no significant hit with E-value <= 1e-10 found for contig00060
              Warning: no significant hit with E-value <= 1e-10 found for contig00061
              Warning: no significant hit with E-value <= 1e-10 found for contig00063
              Warning: no significant hit with E-value <= 1e-10 found for contig00064
              Warning: no significant hit with E-value <= 1e-10 found for contig00065
              Warning: no significant hit with E-value <= 1e-10 found for contig00066
              Warning: no significant hit with E-value <= 1e-10 found for contig00068
              Warning: no significant hit with E-value <= 1e-10 found for contig00069
              Warning: no significant hit with E-value <= 1e-10 found for contig00070
              Warning: no significant hit with E-value <= 1e-10 found for contig00072
              Warning: no significant hit with E-value <= 1e-10 found for contig00073
              Warning: no significant hit with E-value <= 1e-10 found for contig00074
              Warning: no significant hit with E-value <= 1e-10 found for contig00075
              Warning: no significant hit with E-value <= 1e-10 found for contig00076
              Warning: no significant hit with E-value <= 1e-10 found for contig00077
              Warning: no significant hit with E-value <= 1e-10 found for contig00078
              Warning: no significant hit with E-value <= 1e-10 found for contig00083
              Warning: no significant hit with E-value <= 1e-10 found for contig00084
              Warning: no significant hit with E-value <= 1e-10 found for contig00085
              Warning: no significant hit with E-value <= 1e-10 found for contig00086
              Warning: no significant hit with E-value <= 1e-10 found for contig00089
              Warning: no significant hit with E-value <= 1e-10 found for contig00090
              Warning: no significant hit with E-value <= 1e-10 found for contig00091
              Warning: no significant hit with E-value <= 1e-10 found for contig00092
              Warning: no significant hit with E-value <= 1e-10 found for contig00094
              Warning: no significant hit with E-value <= 1e-10 found for contig00096
              Warning: no significant hit with E-value <= 1e-10 found for contig00097
              Warning: no significant hit with E-value <= 1e-10 found for contig00101
              Warning: no significant hit with E-value <= 1e-10 found for contig00102
              Warning: no significant hit with E-value <= 1e-10 found for contig00103
              Warning: no significant hit with E-value <= 1e-10 found for contig00105
              Warning: no significant hit with E-value <= 1e-10 found for contig00106
              Warning: no significant hit with E-value <= 1e-10 found for contig00109
              Warning: no significant hit with E-value <= 1e-10 found for contig00110
              Warning: no significant hit with E-value <= 1e-10 found for contig00112
              Warning: no significant hit with E-value <= 1e-10 found for contig00113
              Warning: no significant hit with E-value <= 1e-10 found for contig00116
              Warning: no significant hit with E-value <= 1e-10 found for contig00117
              Warning: no significant hit with E-value <= 1e-10 found for contig00119
              Warning: no significant hit with E-value <= 1e-10 found for contig00120
              Warning: no significant hit with E-value <= 1e-10 found for contig00121
              Warning: no significant hit with E-value <= 1e-10 found for contig00122
              Warning: no significant hit with E-value <= 1e-10 found for contig00124
              Warning: no significant hit with E-value <= 1e-10 found for contig00128
              Warning: no significant hit with E-value <= 1e-10 found for contig00129
              Warning: no significant hit with E-value <= 1e-10 found for contig00133
              Warning: no significant hit with E-value <= 1e-10 found for contig00134
              Warning: no significant hit with E-value <= 1e-10 found for contig00135
              Warning: no significant hit with E-value <= 1e-10 found for contig00139
              Warning: no significant hit with E-value <= 1e-10 found for contig00140
              Warning: no significant hit with E-value <= 1e-10 found for contig00141
              Warning: no significant hit with E-value <= 1e-10 found for contig00143
              Warning: no significant hit with E-value <= 1e-10 found for contig00144
              Warning: no significant hit with E-value <= 1e-10 found for contig00146
              Warning: no significant hit with E-value <= 1e-10 found for contig00149
              Begin addNonORFcopy at Mon Sep 23 20:00:33 2024
              Finish addNonORFcopy at Mon Sep 23 20:00:33 2024
              Begin addNonORFcopy1 at Mon Sep 23 20:00:38 2024
              Finish addNonORFcopy1 at Mon Sep 23 20:00:38 2024
              getFullIS() begins at Mon Sep 23 20:00:38 2024
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -32-268 around ORF (('contig00007', 1, 118, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00007', 1, 118, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 66624-66924 66741-66891 around ORF (('contig00007', 66774, 66891, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00007', 66774, 66891, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 73-373 around ORF (('contig00039', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 1, {'orfhits4tpase': [(('contig00039', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 5406-5706 5519-5819 around ORF (('contig00043', 5556, 5669, '-'), 'IS3_206', 3.3e-15, 3.3e-15, 1, {'orfhits4tpase': [(('contig00043', 5556, 5669, '-'), 'IS3_206', 3.3e-15, 3.3e-15, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 23685-23985 23802-23952 around ORF (('contig00049', 23835, 23952, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00049', 23835, 23952, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 117-417 around ORF (('contig00062', 1, 267, '-'), 'IS6_292', 5.6e-39, 5.6e-39, 1, {'orfhits4tpase': [(('contig00062', 1, 267, '-'), 'IS6_292', 5.6e-39, 5.6e-39, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 124-424 387-687 around ORF (('contig00062', 274, 537, '-'), 'IS6_292', 1.4e-45, 1.4e-45, 1, {'orfhits4tpase': [(('contig00062', 274, 537, '-'), 'IS6_292', 1.4e-45, 1.4e-45, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -15-285 around ORF (('contig00079', 1, 135, '+'), 'IS256_162', 1.9e-13, 1.9e-13, 1, {'orfhits4tpase': [(('contig00079', 1, 135, '+'), 'IS256_162', 1.9e-13, 1.9e-13, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 54-354 around ORF (('contig00081', 1, 204, '+'), 'IS256_162', 1.1e-12, 1.1e-12, 1, {'orfhits4tpase': [(('contig00081', 1, 204, '+'), 'IS256_162', 1.1e-12, 1.1e-12, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 9029-9329 9145-9295 around ORF (('contig00081', 9179, 9295, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00081', 9179, 9295, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 8293-8593 8547-8847 around ORF (('contig00082', 8443, 8697, '-'), 'IS256_128', 1.9e-28, 1.9e-28, 1, {'orfhits4tpase': [(('contig00082', 8443, 8697, '-'), 'IS256_128', 1.9e-28, 1.9e-28, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -33-267 around ORF (('contig00093', 1, 117, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00093', 1, 117, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 2055-2355 2192-2342 around ORF (('contig00100', 2205, 2342, '+'), 'IS6_292', 4.9e-21, 4.9e-21, 1, {'orfhits4tpase': [(('contig00100', 2205, 2342, '+'), 'IS6_292', 4.9e-21, 4.9e-21, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 150-300 around ORF (('contig00130', 1, 300, '+'), 'IS30_241', 3.5e-50, 3.5e-50, 1, {'orfhits4tpase': [(('contig00130', 1, 300, '+'), 'IS30_241', 3.5e-50, 3.5e-50, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 105-255 around ORF (('contig00136', 1, 255, '+'), 'IS6_292', 1.4e-46, 1.4e-46, 1, {'orfhits4tpase': [(('contig00136', 1, 255, '+'), 'IS6_292', 1.4e-46, 1.4e-46, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 105-255 around ORF (('contig00137', 1, 255, '+'), 'IS30_241', 1.2e-41, 1.2e-41, 1, {'orfhits4tpase': [(('contig00137', 1, 255, '+'), 'IS30_241', 1.2e-41, 1.2e-41, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 73-255 around ORF (('contig00138', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 1, {'orfhits4tpase': [(('contig00138', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 99-249 around ORF (('contig00145', 1, 249, '-'), 'IS6_292', 1.4e-34, 1.4e-34, 1, {'orfhits4tpase': [(('contig00145', 1, 249, '-'), 'IS6_292', 1.4e-34, 1.4e-34, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 81-231 around ORF (('contig00147', 1, 231, '-'), 'IS6_292', 4.6e-41, 4.6e-41, 1, {'orfhits4tpase': [(('contig00147', 1, 231, '-'), 'IS6_292', 4.6e-41, 4.6e-41, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 1-151 around ORF (('contig00150', 1, 151, '-'), 'IS6_292', 6.4e-26, 6.4e-26, 1, {'orfhits4tpase': [(('contig00150', 1, 151, '-'), 'IS6_292', 6.4e-26, 6.4e-26, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -32-618 around ORF (('contig00007', 1, 118, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00007', 1, 118, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 66274-66924 66741-66891 around ORF (('contig00007', 66774, 66891, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00007', 66774, 66891, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 73-723 around ORF (('contig00039', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 1, {'orfhits4tpase': [(('contig00039', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 5056-5706 5519-6169 around ORF (('contig00043', 5556, 5669, '-'), 'IS3_206', 3.3e-15, 3.3e-15, 1, {'orfhits4tpase': [(('contig00043', 5556, 5669, '-'), 'IS3_206', 3.3e-15, 3.3e-15, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 23335-23985 23802-23952 around ORF (('contig00049', 23835, 23952, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00049', 23835, 23952, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 117-767 around ORF (('contig00062', 1, 267, '-'), 'IS6_292', 5.6e-39, 5.6e-39, 1, {'orfhits4tpase': [(('contig00062', 1, 267, '-'), 'IS6_292', 5.6e-39, 5.6e-39, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-424 387-1037 around ORF (('contig00062', 274, 537, '-'), 'IS6_292', 1.4e-45, 1.4e-45, 1, {'orfhits4tpase': [(('contig00062', 274, 537, '-'), 'IS6_292', 1.4e-45, 1.4e-45, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -15-635 around ORF (('contig00079', 1, 135, '+'), 'IS256_162', 1.9e-13, 1.9e-13, 1, {'orfhits4tpase': [(('contig00079', 1, 135, '+'), 'IS256_162', 1.9e-13, 1.9e-13, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 54-704 around ORF (('contig00081', 1, 204, '+'), 'IS256_162', 1.1e-12, 1.1e-12, 1, {'orfhits4tpase': [(('contig00081', 1, 204, '+'), 'IS256_162', 1.1e-12, 1.1e-12, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 8679-9329 9145-9295 around ORF (('contig00081', 9179, 9295, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00081', 9179, 9295, '-'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 7943-8593 8547-8939 around ORF (('contig00082', 8443, 8697, '-'), 'IS256_128', 1.9e-28, 1.9e-28, 1, {'orfhits4tpase': [(('contig00082', 8443, 8697, '-'), 'IS256_128', 1.9e-28, 1.9e-28, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 -33-617 around ORF (('contig00093', 1, 117, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 1, {'orfhits4tpase': [(('contig00093', 1, 117, '+'), 'IS30_241', 4.7e-11, 4.7e-11, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1705-2355 2192-2342 around ORF (('contig00100', 2205, 2342, '+'), 'IS6_292', 4.9e-21, 4.9e-21, 1, {'orfhits4tpase': [(('contig00100', 2205, 2342, '+'), 'IS6_292', 4.9e-21, 4.9e-21, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 150-300 around ORF (('contig00130', 1, 300, '+'), 'IS30_241', 3.5e-50, 3.5e-50, 1, {'orfhits4tpase': [(('contig00130', 1, 300, '+'), 'IS30_241', 3.5e-50, 3.5e-50, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 105-255 around ORF (('contig00136', 1, 255, '+'), 'IS6_292', 1.4e-46, 1.4e-46, 1, {'orfhits4tpase': [(('contig00136', 1, 255, '+'), 'IS6_292', 1.4e-46, 1.4e-46, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 105-255 around ORF (('contig00137', 1, 255, '+'), 'IS30_241', 1.2e-41, 1.2e-41, 1, {'orfhits4tpase': [(('contig00137', 1, 255, '+'), 'IS30_241', 1.2e-41, 1.2e-41, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 73-255 around ORF (('contig00138', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 1, {'orfhits4tpase': [(('contig00138', 1, 223, '-'), 'IS30_241', 8.5e-32, 8.5e-32, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 99-249 around ORF (('contig00145', 1, 249, '-'), 'IS6_292', 1.4e-34, 1.4e-34, 1, {'orfhits4tpase': [(('contig00145', 1, 249, '-'), 'IS6_292', 1.4e-34, 1.4e-34, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 81-231 around ORF (('contig00147', 1, 231, '-'), 'IS6_292', 4.6e-41, 4.6e-41, 1, {'orfhits4tpase': [(('contig00147', 1, 231, '-'), 'IS6_292', 4.6e-41, 4.6e-41, 0)]})
              No tir will be found in the invalid tir search window (org= fastafile=input): 1-151 1-151 around ORF (('contig00150', 1, 151, '-'), 'IS6_292', 6.4e-26, 6.4e-26, 1, {'orfhits4tpase': [(('contig00150', 1, 151, '-'), 'IS6_292', 6.4e-26, 6.4e-26, 0)]})
              Start typing IS elements
              Warning: no valid hit found for contig00001
              The single-copy partial IS element with evalue > 1e-50: isLen=4305 IS21 bd=[38191, 42495] orf('contig00006', 38536, 42164, '+') evalue=6.5e-11
              The partial IS element with isLen < 1027: isLen=118 IS30 bd=[1, 118] orf('contig00007', 1, 118, '+') evalue=4.7e-11
              The partial IS element with isLen < 1027: isLen=118 IS30 bd=[66774, 66891] orf('contig00007', 66774, 66891, '-') evalue=4.7e-11
              The single-copy partial IS element with evalue > 1e-50: isLen=1715 ISL3 bd=[88, 1802] orf('contig00009', 187, 1613, '+') evalue=1.4e-44
              The partial IS element with isLen < 1924: isLen=1542 IS21 bd=[46818, 48359] orf('contig00010', 46976, 48319, '+') evalue=6.5e-15
              Warning: no valid hit found for contig00015
              Warning: no valid hit found for contig00016
              Warning: no valid hit found for contig00018
              Warning: no valid hit found for contig00019
              Warning: no valid hit found for contig00025
              The partial IS element with isLen < 1924: isLen=1849 IS21 bd=[5545, 7393] orf('contig00029', 5881, 7182, '-') evalue=6.3e-13
              Warning: no valid hit found for contig00038
              The partial IS element with isLen < 1027: isLen=223 IS30 bd=[1, 223] orf('contig00039', 1, 223, '-') evalue=8.5e-32
              The partial IS element with isLen < 435: isLen=114 IS3 bd=[5556, 5669] orf('contig00043', 5556, 5669, '-') evalue=3.3e-15
              The partial IS element with isLen < 1027: isLen=118 IS30 bd=[23835, 23952] orf('contig00049', 23835, 23952, '-') evalue=4.7e-11
              Warning: no valid hit found for contig00052
              Warning: no valid hit found for contig00056
              The partial IS element with isLen < 696: isLen=267 IS6 bd=[1, 267] orf('contig00062', 1, 267, '-') evalue=5.6e-39
              The partial IS element with isLen < 696: isLen=264 IS6 bd=[274, 537] orf('contig00062', 274, 537, '-') evalue=1.4e-45
              The single-copy partial IS element with evalue > 1e-50: isLen=911 IS3 bd=[8088, 8998] orf('contig00062', 7964, 9027, '-') evalue=5.5e-49
              The partial IS element with isLen < 1124: isLen=135 IS256 bd=[1, 135] orf('contig00079', 1, 135, '+') evalue=1.9e-13
              Warning: no valid hit found for contig00080
              The partial IS element with isLen < 1124: isLen=204 IS256 bd=[1, 204] orf('contig00081', 1, 204, '+') evalue=1.1e-12
              The single-copy partial IS element with evalue > 1e-50: isLen=1546 ISL3 bd=[1334, 2879] orf('contig00081', 1766, 2566, '-') evalue=1.1e-49
              The partial IS element with isLen < 1027: isLen=117 IS30 bd=[9179, 9295] orf('contig00081', 9179, 9295, '-') evalue=4.7e-11
              The partial IS element with isLen < 1124: isLen=964 IS256 bd=[7766, 8729] orf('contig00082', 7727, 8349, '-') evalue=1.2e-67
              The partial IS element with isLen < 1124: isLen=255 IS256 bd=[8443, 8697] orf('contig00082', 8443, 8697, '-') evalue=1.9e-28
              The single-copy partial IS element with evalue > 1e-50: isLen=1703 ISL3 bd=[3784, 5486] orf('contig00087', 3948, 5150, '-') evalue=1.8e-38
              Warning: no valid hit found for contig00088
              The partial IS element with isLen < 1027: isLen=117 IS30 bd=[1, 117] orf('contig00093', 1, 117, '+') evalue=4.7e-11
              The partial IS element with isLen < 1124: isLen=649 IS256 bd=[1683, 2331] orf('contig00098', 1792, 2452, '+') evalue=4.1e-99
              Warning: no valid hit found for contig00099
              The partial IS element with isLen < 696: isLen=138 IS6 bd=[2205, 2342] orf('contig00100', 2205, 2342, '+') evalue=4.9e-21
              The single-copy partial IS element with evalue > 1e-50: isLen=1353 IS110 bd=[163, 1515] orf('contig00104', 141, 1391, '-') evalue=1e-33
              The single-copy partial IS element with evalue > 1e-50: isLen=1404 ISL3 bd=[75, 1478] orf('contig00107', 84, 1367, '-') evalue=2.1e-50
              The partial IS element with isLen < 1027: isLen=491 IS30 bd=[102, 592] orf('contig00114', 1, 652, '+') evalue=6.2e-113
              The partial IS element with isLen < 1124: isLen=612 IS256 bd=[12, 623] orf('contig00115', 1, 649, '+') evalue=2.4e-108
              The partial IS element with isLen < 1124: isLen=429 IS256 bd=[11, 439] orf('contig00118', 1, 445, '-') evalue=1.5e-63
              The partial IS element with isLen < 1027: isLen=130 IS30 bd=[110, 239] orf('contig00125', 10, 348, '-') evalue=3.3e-51
              The partial IS element with isLen < 1124: isLen=238 IS256 bd=[23, 260] orf('contig00126', 1, 338, '-') evalue=8.8e-54
              The partial IS element with isLen < 696: isLen=332 IS6 bd=[1, 332] orf('contig00127', 1, 332, '-') evalue=3.3e-26
              The partial IS element with isLen < 1027: isLen=300 IS30 bd=[1, 300] orf('contig00130', 1, 300, '+') evalue=3.5e-50
              The partial IS element with isLen < 696: isLen=255 IS6 bd=[1, 255] orf('contig00136', 1, 255, '+') evalue=1.4e-46
              The partial IS element with isLen < 1027: isLen=255 IS30 bd=[1, 255] orf('contig00137', 1, 255, '+') evalue=1.2e-41
              The partial IS element with isLen < 1027: isLen=223 IS30 bd=[1, 223] orf('contig00138', 1, 223, '-') evalue=8.5e-32
              The partial IS element with isLen < 696: isLen=249 IS6 bd=[1, 249] orf('contig00145', 1, 249, '-') evalue=1.4e-34
              The partial IS element with isLen < 696: isLen=231 IS6 bd=[1, 231] orf('contig00147', 1, 231, '-') evalue=4.6e-41
              The partial IS element with isLen < 696: isLen=151 IS6 bd=[1, 151] orf('contig00150', 1, 151, '-') evalue=6.4e-26
              Warning: no valid hit after removing short IS element candidate for contig00001
              Warning: no valid hit after removing short IS element candidate for contig00015
              Warning: no valid hit after removing short IS element candidate for contig00016
              Warning: no valid hit after removing short IS element candidate for contig00018
              Warning: no valid hit after removing short IS element candidate for contig00019
              Warning: no valid hit after removing short IS element candidate for contig00025
              Warning: no valid hit after removing short IS element candidate for contig00038
              Warning: no valid hit after removing short IS element candidate for contig00052
              Warning: no valid hit after removing short IS element candidate for contig00056
              Warning: no valid hit after removing short IS element candidate for contig00080
              Warning: no valid hit after removing short IS element candidate for contig00088
              Warning: no valid hit after removing short IS element candidate for contig00099
              Finish typing partial IS elements
              Begin removeOverlappedHits at Mon Sep 23 20:00:38 2024
              contig00006: no intersected hits found
              contig00007: no intersected hits found
              contig00009: no intersected hits found
              contig00010: no intersected hits found
              contig00029: no intersected hits found
              contig00039: no intersected hits found
              contig00043: 2 intersected hits found, do clustering to pick the representative hit for each cluster
              contig00049: no intersected hits found
              contig00062: no intersected hits found
              contig00067: no intersected hits found
              contig00071: no intersected hits found
              contig00079: no intersected hits found
              contig00081: no intersected hits found
              contig00082: 2 intersected hits found, do clustering to pick the representative hit for each cluster
              contig00087: no intersected hits found
              contig00093: no intersected hits found
              contig00095: no intersected hits found
              contig00098: no intersected hits found
              contig00100: no intersected hits found
              contig00104: no intersected hits found
              contig00107: no intersected hits found
              contig00108: no intersected hits found
              contig00111: no intersected hits found
              contig00114: no intersected hits found
              contig00115: no intersected hits found
              contig00118: no intersected hits found
              contig00125: no intersected hits found
              contig00126: no intersected hits found
              contig00127: no intersected hits found
              contig00130: no intersected hits found
              contig00136: no intersected hits found
              contig00137: no intersected hits found
              contig00138: no intersected hits found
              contig00145: no intersected hits found
              contig00147: no intersected hits found
              contig00150: no intersected hits found
              Finish removeOverlappedHits at Mon Sep 23 20:00:38 2024
              Begin reading protein database at Mon Sep 23 20:00:38 2024
              Finish reading protein database at Mon Sep 23 20:00:38 2024
              Write IS elements from all sequences in input into one result file under results
              Write 45 IS copies to results/input.csv and results/input.tsv and results/input.raw
              Write summarized result to results/input.sum
              End in pred Mon Sep 23 20:00:38 2024
              Both complete and partial IS elements are reported.
              ISEScan ends at Mon Sep 23 20:00:38 2024
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              log_activate true
              remove_short_is false
      • Step 6: genomic_annotation_integron:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • integron_finder '/tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat' --cpu ${GALAXY_SLOTS:-2} --keep-tmp --local-max --promoter-attI -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40       && mv Results_Integron_Finder_* Results_Integron_Finder

            Exit Code:

            • 0

            Standard Output:

            • **************************************************************************
               ___       _                               _____ _           _
              |_ _|_ __ | |_ ___  __ _ _ __ ___  _ __   |  ___(_)_ __   __| | ___ _ __
               | || '_ \| __/ _ \/ _` | '__/ _ \| '_ \  | |_  | | '_ \ / _` |/ _ \ '__|
               | || | | | ||  __/ (_| | | | (_) | | | | |  _| | | | | | (_| |  __/ |
              |___|_| |_|\__\___|\__, |_|  \___/|_| |_| |_|   |_|_| |_|\__,_|\___|_|
                                 |___/
              
              **************************************************************************
              
              integron_finder version 2.0.5 
              Using:
               - Python 3.12.3 | packaged by conda-forge | (main, Apr 15 2024, 18:38:13) [GCC 12.3.0]
               - numpy 1.26.4
               - pandas 2.2.2
               - matplolib 3.8.4
               - biopython 1.83
              
               - Prodigal V2.6.3: February, 2016
               - INFERNAL 1.1.4 (Dec 2020)
               - HMMER 3.3.2 (Nov 2020); http://hmmer.org/
              
              Authors:
               - Jean Cury, Bertrand Neron, Eduardo Rocha,
              
              Citation:
              
               Néron, B.; Littner, E.; Haudiquet, M.; Perrin, A.; Cury, J.; Rocha, E.P.C. 
               IntegronFinder 2.0: Identification and Analysis of Integrons across Bacteria, with a Focus on Antibiotic Resistance in Klebsiella. 
               Microorganisms 2022, 10, 700. https://doi.org/10.3390/microorganisms10040700
              
               If you use --func-annot in conjunction with file NCBIfam-AMRFinder.hmm please also cite
              
               Haft, DH et al., Nucleic Acids Res. 2018 Jan 4;46(D1):D851-D860
               PMID: 29112715
               
              
                                   =======================
              
              integron_finder is free software: you can redistribute it and/or modify
              it under the terms of the GNU General Public License as published by
              the Free Software Foundation, either version 3 of the License, or
              (at your option) any later version.
              
              integron_finder is distributed in the hope that it will be useful,
              but WITHOUT ANY WARRANTY; without even the implied warranty of
              MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
              GNU General Public License for more details.
              
              You should have received a copy of the GNU General Public License
              along with this program (COPYING file).
              If not, see <http://www.gnu.org/licenses/>.
              
                                   =======================
              
              command used: integron_finder /tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat --cpu 1 --keep-tmp --local-max --promoter-attI -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40
              
                                   =======================
              
              �[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00001 (1/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00001, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00001, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00001�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00002 (2/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00002, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00002, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00002�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00003 (3/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00003, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00003, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00003�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00004 (4/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00004, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00004, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00004�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00005 (5/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00005, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00005, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00005�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00006 (6/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00006, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00006, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00006�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00007 (7/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00007, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00007, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00007�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00008 (8/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00008, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00008, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00008�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00009 (9/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00009, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 1 CALIN element(s) found with a total of 1 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m 	searched 45496->49696 in top strand(s) found 0 attc sites�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00009, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 1 CALIN element(s) found with a total of 2 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Adding proteins ... :�[0m
              �[32mINFO     : �[0m Adding promoters and attI ... :�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00009�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00010 (10/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00010, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00010, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00010�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00011 (11/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00011, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00011, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00011�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00012 (12/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00012, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00012, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00012�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00013 (13/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00013, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00013, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00013�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00014 (14/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00014, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00014, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     
              ..
               Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00134, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00134, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00134�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00135 (135/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00135, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00135, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00135�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00136 (136/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00136, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00136, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00136�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00137 (137/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00137, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00137, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00137�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00138 (138/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00138, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00138, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00138�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00139 (139/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00139, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00139, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00139�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00140 (140/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00140, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00140, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00140�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00141 (141/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00141, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00141, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00141�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00142 (142/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00142/contig00142.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00142 ############�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00143 (143/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00143, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00143, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00143�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00144 (144/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00144, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00144, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00144�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00145 (145/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00145, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00145, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00145�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00146 (146/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00146, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00146, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00146�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00147 (147/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00147, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00147, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00147�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00148 (148/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00148/contig00148.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00148 ############�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00149 (149/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00149/contig00149.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00149 ############�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00150 (150/153) ############
              �[0m
              �[32mINFO     : �[0m Starting Default search ... :�[0m
              �[32mINFO     : �[0m Default search done... : �[0m
              �[32mINFO     : �[0m In replicon contig00150, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Starting search with local_max...:�[0m
              �[32mINFO     : �[0m Search with local_max done... :�[0m
              �[32mINFO     : �[0m In replicon contig00150, there are:�[0m
              �[32mINFO     : �[0m - 0 complete integron(s) found with a total 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 CALIN element(s) found with a total of 0 attC site(s)�[0m
              �[32mINFO     : �[0m - 0 In0 element(s) found with a total of 0 attC site�[0m
              �[32mINFO     : �[0m Writing out results for replicon contig00150�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00151 (151/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00151/contig00151.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00151 ############�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00152 (152/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00152/contig00152.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00152 ############�[0m
              �[32mINFO     : �[0m ############ Processing replicon contig00153 (153/153) ############
              �[0m
              �[33mWARNING  : �[0m The protein file: '/tmp/tmpl1obw4de/job_working_directory/000/9/working/Results_Integron_Finder_dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1/tmp_contig00153/contig00153.prt' is empty cannot perform hmmsearch on it.�[0m
              �[33mWARNING  : �[0m ############ Skip replicon contig00153 ############�[0m
              �[32mINFO     : �[0m Merging integrons results.
              �[0m
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              gbk false
              local_max true
              no_logfile false
              pdf false
              promoter_attI true
              settings {"attc_settings": {"calin_threshold": "2", "covar_matrix": null, "dist_thresh": "4000", "keep_palindromes": false, "max_attc_size": "200", "min_attc_size": "40"}, "protein_settings": {"func_annot": false, "no_proteins": false, "union_integrases": false}}
              topology_file None
              type_replicon None
      • Step 7: genomic_annotation_plasmid_plasmidfinder:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir output_dir && mkdir temp_dir && plasmidfinder.py -i '/tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat' -p '/cvmfs/data.galaxyproject.org/byhand/plasmidfinder-db/81c11f4_2023_12_04' -l '0.6' -t '0.95' -mp blastn -x -o output_dir -tmp temp_dir | tee 'XXXX'

            Exit Code:

            • 0

            Standard Output:

            • Found: rep22_1b_repB(pAMalpha1)_AF503772
              Saving: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530:1166..1957:rep22_1b_repB(pAMalpha1)_AF503772:78.805970
              Found: repUS12_1_rep(pUB110)_AF181950
              Same contig: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530
              	repUS12_1_rep(pUB110)_AF181950 vs rep22_1b_repB(pAMalpha1)_AF503772
              	overlap found (791): repUS12_1_rep(pUB110)_AF181950
              Found: repUS12_2_repB(SAP014A)_GQ900379
              Same contig: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530
              	repUS12_2_repB(SAP014A)_GQ900379 vs rep22_1b_repB(pAMalpha1)_AF503772
              	overlap found (770): repUS12_2_repB(SAP014A)_GQ900379
              	791 <= 1561
              		Scores: 88.01369863013699 cmp 78.80597014925374
              Saving: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530:1187..1957:repUS12_2_repB(SAP014A)_GQ900379:88.013699
              Found: rep22_1a_repB(pUB110)_X03408
              Same contig: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep22_1a_repB(pUB110)_X03408 vs repUS12_2_repB(SAP014A)_GQ900379
              	overlap found (494): rep22_1a_repB(pUB110)_X03408
              	770 <= 1264
              		Scores: 69.91525423728814 cmp 88.01369863013699
              Found: rep22_2_repU(pKKS825)_FN377602
              Same contig: contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep22_2_repU(pKKS825)_FN377602 vs repUS12_2_repB(SAP014A)_GQ900379
              	overlap found (457): rep22_2_repU(pKKS825)_FN377602
              	770 <= 1227
              		Scores: 38.40947546531303 cmp 88.01369863013699
              Found: repUS40_1_repB(pE394)_KP399637
              Saving: contig00038 len=35051 cov=12.9 corr=0 origname=NODE_38_length_35051_cov_12.911408_pilon sw=shovill-spades/1.1.0 date=20240530:21156..22313:repUS40_1_repB(pE394)_KP399637:100.000000
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00044 len=27996 cov=4.1 corr=10 origname=NODE_44_length_27996_cov_4.112455_pilon sw=shovill-spades/1.1.0 date=20240530:27871..27907:rep18b_2_repA(pEF418)_AF408195:6.560284
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00062 len=16064 cov=5.0 corr=6 origname=NODE_62_length_16064_cov_4.979105_pilon sw=shovill-spades/1.1.0 date=20240530:569..608:rep18b_2_repA(pEF418)_AF408195:6.746238
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00076 len=11206 cov=4.6 corr=3 origname=NODE_76_length_11206_cov_4.625688_pilon sw=shovill-spades/1.1.0 date=20240530:91..127:rep18b_2_repA(pEF418)_AF408195:6.382979
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00100 len=2342 cov=4.7 corr=1 origname=NODE_100_length_2342_cov_4.734086_pilon sw=shovill-spades/1.1.0 date=20240530:2133..2173:rep18b_2_repA(pEF418)_AF408195:7.092199
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00111 len=1300 cov=4.2 corr=0 origname=NODE_111_length_1300_cov_4.218244_pilon sw=shovill-spades/1.1.0 date=20240530:1174..1210:rep18b_2_repA(pEF418)_AF408195:6.560284
              Found: rep18b_2_repA(pEF418)_AF408195
              Same contig: contig00111 len=1300 cov=4.2 corr=0 origname=NODE_111_length_1300_cov_4.218244_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00111 len=1300 cov=4.2 corr=0 origname=NODE_111_length_1300_cov_4.218244_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep18b_2_repA(pEF418)_AF408195 vs rep18b_2_repA(pEF418)_AF408195
              	ignore overlap (-1048): rep18b_2_repA(pEF418)_AF408195
              Saving: contig00111 len=1300 cov=4.2 corr=0 origname=NODE_111_length_1300_cov_4.218244_pilon sw=shovill-spades/1.1.0 date=20240530:90..126:rep18b_2_repA(pEF418)_AF408195:6.560284
              Found: rep18b_2_repA(pEF418)_AF408195
              Saving: contig00121 len=378 cov=5.8 corr=0 origname=NODE_121_length_378_cov_5.812749_pilon sw=shovill-spades/1.1.0 date=20240530:249..289:rep18b_2_repA(pEF418)_AF408195:7.092199
              Found: rep9b_2_prgW(EF62pC)_CP002494
              Saving: contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530:17733..18746:rep9b_2_prgW(EF62pC)_CP002494:100.000000
              Found: rep9b_1_prgW(pBEE99)_GU046453
              Same contig: contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep9b_1_prgW(pBEE99)_GU046453 vs rep9b_2_prgW(EF62pC)_CP002494
              	overlap found (1013): rep9b_1_prgW(pBEE99)_GU046453
              Found: rep9b_4_repA2(pTEF2)_AE016831
              Same contig: contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep9b_4_repA2(pTEF2)_AE016831 vs rep9b_2_prgW(EF62pC)_CP002494
              	overlap found (956): rep9b_4_repA2(pTEF2)_AE016831
              	1013 <= 1969
              		Scores: 92.98159121140806 cmp 100.0
              Found: rep9b_3_repA(pMG2200)_AB374546
              Same contig: contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00016 len=60038 cov=9.4 corr=0 origname=NODE_16_length_60038_cov_9.358382_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep9b_3_repA(pMG2200)_AB374546 vs rep9b_2_prgW(EF62pC)_CP002494
              	overlap found (942): rep9b_3_repA(pMG2200)_AB374546
              	1013 <= 1955
              		Scores: 90.4794483118106 cmp 100.0
              Found: repUS43_1_CDS12738(DOp1)_CP003584
              Saving: contig00075 len=12074 cov=14.1 corr=0 origname=NODE_75_length_12074_cov_14.063531_pilon sw=shovill-spades/1.1.0 date=20240530:8225..9430:repUS43_1_CDS12738(DOp1)_CP003584:100.000000
              Found: rep7a_8_ORF11(pRE25)_X92945
              Saving: contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530:1123..2061:rep7a_8_ORF11(pRE25)_X92945:100.000000
              Found: rep7a_7_rep(pKH7)_NC002096
              Same contig: contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep7a_7_rep(pKH7)_NC002096 vs rep7a_8_ORF11(pRE25)_X92945
              	overlap found (864): rep7a_7_rep(pKH7)_NC002096
              	938 <= 1802
              		Scores: 90.2465166130761 cmp 100.0
              Found: rep7a_9_repI(pGB354)_SAU83488
              Same contig: contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530 == contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530
              	rep7a_9_repI(pGB354)_SAU83488 vs rep7a_8_ORF11(pRE25)_X92945
              	overlap found (595): rep7a_9_repI(pGB354)_SAU83488
              	938 <= 1533
              		Scores: 99.49804859024323 cmp 100.0
              {'plasmidfinder': {'results': {'Enterobacteriales': {'enterobacteriales': 'No '
                                                                                        'hit '
                                                                                        'found'},
                                             'Gram Positive': {'Inc18': 'No hit found',
                                                               'NT_Rep': 'No hit found',
                                                               'Rep1': {'contig00102 len=2082 cov=4.1 corr=0 origname=NODE_102_length_2082_cov_4.148849_pilon sw=shovill-spades/1.1.0 date=20240530:1187..1957:repUS12_2_repB(SAP014A)_GQ900379:88.013699': {'HSP_length': 771,
                                                                                                                                                                                                                                                             'accession': 'GQ900379',
                                                                                                                                                                                                                                                             'contig_name': 'contig00102 '
                                                                                                                                                                                                                                                                            'len=2082 '
                                                                                                                                                                                                                                                                            'cov=4.1 '
                                                                                                                                                                                                                                                                            'corr=0 '
                                                                                                                                                                                                                                                                            'origname=NODE_102_length_2082_cov_4.148849_pilon '
                                                                                                                                                                                                                                                                            'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                            'date=20240530',
                                                                                                                                                                                                                                                             'coverage': 88.01,
                                                                                                                                                                                                                                                             'hit_id': 'contig00102 '
                                                                                                                                                                                                                                                                       'len=2082 '
                                                                                                                                                                                                                                                                       'cov=4.1 '
                                                                                                                                                                                                                                                                       'corr=0 '
                                                                                                                                                                                                                                                                       'origname=NODE_102_length_2082_cov_4.148849_pilon '
                                                                                                                                                                                                                                                                       'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                       'date=20240530:1187..1957:repUS12_2_repB(SAP014A)_GQ900379:88.013699',
                                                                                                                                                                                                                                                             'identity': 100.0,
                                                                                                                                                                                                                                                             'note': 'repB(SAP014A)',
                                                                                                                                                                                                                                                             'plasmid': 'repUS12',
                                                                                                                                                                                                                                                             'position_in_ref': '1..771',
                                                                                                                                                                                                                                                             'positions_in_contig': '1187..1957',
                                                                                                                                                                                                                                                             'template_length': 876}},
                                                               'Rep2': 'No hit found',
                                                               'Rep3': {'contig00038 len=35051 cov=12.9 corr=0 origname=NODE_38_length_35051_cov_12.911408_pilon sw=shovill-spades/1.1.0 date=20240530:21156..22313:repUS40_1_repB(pE394)_KP399637:100.000000': {'HSP_length': 1158,
                                                                                                                                                                                                                                                                 'accession': 'KP399637',
                                                                                                                                                                                                                                                                 'contig_name': 'contig00038 '
                                                                                                                                                                                                                                                                                'len=35051 '
                                                                                                                                                                                                                                                                                'cov=12.9 '
                                                                                                                                                                                                                                                                                'corr=0 '
                                                                                                                                                                                                                                                                                'origname=NODE_38_length_35051_cov_12.911408_pilon '
                                                                                                                                                                                                                                                                                'sw=shovill-spades/1.1.0 '
                                                                                                                
              ..
                                                                                                                                                                                                                                                      'len=60038 '
                                                                                                                                                                                                                                                                          'cov=9.4 '
                                                                                                                                                                                                                                                                          'corr=0 '
                                                                                                                                                                                                                                                                          'origname=NODE_16_length_60038_cov_9.358382_pilon '
                                                                                                                                                                                                                                                                          'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                          'date=20240530:17733..18746:rep9b_2_prgW(EF62pC)_CP002494:100.000000',
                                                                                                                                                                                                                                                                'identity': 100.0,
                                                                                                                                                                                                                                                                'note': 'prgW(EF62pC)',
                                                                                                                                                                                                                                                                'plasmid': 'rep9b',
                                                                                                                                                                                                                                                                'position_in_ref': '1..1014',
                                                                                                                                                                                                                                                                'positions_in_contig': '17733..18746',
                                                                                                                                                                                                                                                                'template_length': 1014}},
                                                               'RepL': 'No hit found',
                                                               'Rep_trans': {'contig00075 len=12074 cov=14.1 corr=0 origname=NODE_75_length_12074_cov_14.063531_pilon sw=shovill-spades/1.1.0 date=20240530:8225..9430:repUS43_1_CDS12738(DOp1)_CP003584:100.000000': {'HSP_length': 1206,
                                                                                                                                                                                                                                                                       'accession': 'CP003584',
                                                                                                                                                                                                                                                                       'contig_name': 'contig00075 '
                                                                                                                                                                                                                                                                                      'len=12074 '
                                                                                                                                                                                                                                                                                      'cov=14.1 '
                                                                                                                                                                                                                                                                                      'corr=0 '
                                                                                                                                                                                                                                                                                      'origname=NODE_75_length_12074_cov_14.063531_pilon '
                                                                                                                                                                                                                                                                                      'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                                      'date=20240530',
                                                                                                                                                                                                                                                                       'coverage': 100.0,
                                                                                                                                                                                                                                                                       'hit_id': 'contig00075 '
                                                                                                                                                                                                                                                                                 'len=12074 '
                                                                                                                                                                                                                                                                                 'cov=14.1 '
                                                                                                                                                                                                                                                                                 'corr=0 '
                                                                                                                                                                                                                                                                                 'origname=NODE_75_length_12074_cov_14.063531_pilon '
                                                                                                                                                                                                                                                                                 'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                                 'date=20240530:8225..9430:repUS43_1_CDS12738(DOp1)_CP003584:100.000000',
                                                                                                                                                                                                                                                                       'identity': 100.0,
                                                                                                                                                                                                                                                                       'note': 'CDS12738(DOp1)',
                                                                                                                                                                                                                                                                       'plasmid': 'repUS43',
                                                                                                                                                                                                                                                                       'position_in_ref': '1..1206',
                                                                                                                                                                                                                                                                       'positions_in_contig': '8225..9430',
                                                                                                                                                                                                                                                                       'template_length': 1206},
                                                                             'contig00089 len=5337 cov=4.2 corr=5 origname=NODE_89_length_5337_cov_4.213244_pilon sw=shovill-spades/1.1.0 date=20240530:1123..2061:rep7a_8_ORF11(pRE25)_X92945:100.000000': {'HSP_length': 939,
                                                                                                                                                                                                                                                             'accession': 'X92945',
                                                                                                                                                                                                                                                             'contig_name': 'contig00089 '
                                                                                                                                                                                                                                                                            'len=5337 '
                                                                                                                                                                                                                                                                            'cov=4.2 '
                                                                                                                                                                                                                                                                            'corr=5 '
                                                                                                                                                                                                                                                                            'origname=NODE_89_length_5337_cov_4.213244_pilon '
                                                                                                                                                                                                                                                                            'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                            'date=20240530',
                                                                                                                                                                                                                                                             'coverage': 100.0,
                                                                                                                                                                                                                                                             'hit_id': 'contig00089 '
                                                                                                                                                                                                                                                                       'len=5337 '
                                                                                                                                                                                                                                                                       'cov=4.2 '
                                                                                                                                                                                                                                                                       'corr=5 '
                                                                                                                                                                                                                                                                       'origname=NODE_89_length_5337_cov_4.213244_pilon '
                                                                                                                                                                                                                                                                       'sw=shovill-spades/1.1.0 '
                                                                                                                                                                                                                                                                       'date=20240530:1123..2061:rep7a_8_ORF11(pRE25)_X92945:100.000000',
                                                                                                                                                                                                                                                             'identity': 100.0,
                                                                                                                                                                                                                                                             'note': 'ORF11(pRE25)',
                                                                                                                                                                                                                                                             'plasmid': 'rep7a',
                                                                                                                                                                                                                                                             'position_in_ref': '1..939',
                                                                                                                                                                                                                                                             'positions_in_contig': '1123..2061',
                                                                                                                                                                                                                                                             'template_length': 939}}}},
                                 'run_info': {'date': '23.09.2024', 'time': '19:38:51'},
                                 'user_input': {'file_format': 'fasta',
                                                'filename(s)': ['/tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat'],
                                                'method': 'blast'}}}
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              input {"database_name": "plasmidfinder_81c11f4_2023_12_04", "input_file": {"values": [{"id": 19, "src": "hda"}]}}
              options {"min_cov": "0.6", "threshold": "0.95"}
              output_files {"output_selection": ["hit_fasta", "plasmid_fasta", "result_tsv", "result_txt", "data_json"]}
      • Step 8: toolshed.g2.bx.psu.edu/repos/iuc/bakta/bakta/1.9.4+galaxy0:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir -p ./database_path/amrfinderplus-db && ln -s '/cvmfs/data.galaxyproject.org/byhand/bakta_database/7669534'/* database_path && ln -s '/cvmfs/data.galaxyproject.org/byhand/amrfinderplus-db/amrfinderplus_V3.12_2024-05-02.2/' database_path/amrfinderplus-db/latest &&  bakta --verbose --threads ${GALAXY_SLOTS:-1} --db './database_path' --output 'bakta_output' --min-contig-length 1 --prefix bakta_output  --translation-table '11' --gram '?'     '/tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat' | tee 'XXXX'

            Exit Code:

            • 0

            Standard Output:

            • Bakta v1.9.4
              Options and arguments:
              	input: /tmp/tmpl1obw4de/files/c/3/c/dataset_c3c04a71-efa8-41f1-bcc0-78bbafd578d1.dat
              	db: /tmp/tmpl1obw4de/job_working_directory/000/11/working/database_path, version 5.0, full
              	output: /tmp/tmpl1obw4de/job_working_directory/000/11/working/bakta_output
              	tmp directory: /tmp/tmpl1obw4de/tmp/tmp4gchcl_5
              	prefix: bakta_output
              	threads: 1
              	translation table: 11
              
              parse genome sequences...
              	imported: 153
              	filtered & revised: 153
              	contigs: 153
              
              start annotation...
              predict tRNAs...
              	found: 60
              predict tmRNAs...
              	found: 1
              predict rRNAs...
              	found: 6
              predict ncRNAs...
              	found: 36
              predict ncRNA regions...
              	found: 43
              predict CRISPR arrays...
              	found: 1
              predict & annotate CDSs...
              	predicted: 2886 
              	discarded spurious: 0
              	revised translational exceptions: 0
              	detected IPSs: 2621
              	found PSCs: 205
              	found PSCCs: 30
              	lookup annotations...
              	conduct expert systems...
              		amrfinder: 12
              		protein sequences: 44
              	combine annotations and mark hypotheticals...
              	detect pseudogenes...
              		pseudogene candidates: 19
              		found pseudogenes: 10
              analyze hypothetical proteins: 36
              	detected Pfam hits: 7 
              	calculated proteins statistics
              	revise special cases...
              extract sORF...
              	potential: 42490
              	discarded due to overlaps: 35967
              	discarded spurious: 0
              	detected IPSs: 11
              	found PSCs: 0
              	lookup annotations...
              	filter and combine annotations...
              	filtered sORFs: 5
              detect gaps...
              	found: 0
              detect oriCs/oriVs...
              	found: 4
              detect oriTs...
              	found: 0
              apply feature overlap filters...
              select features and create locus tags...
              selected: 3040
              improve annotations...
              	revised gene symbols: 21
              
              genome statistics:
              	Genome size: 3,027,467 bp
              	Contigs/replicons: 153
              	GC: 37.3 %
              	N50: 44,557
              	N ratio: 0.0 %
              	coding density: 86.7 %
              
              annotation summary:
              	tRNAs: 59
              	tmRNAs: 1
              	rRNAs: 6
              	ncRNAs: 36
              	ncRNA regions: 43
              	CRISPR arrays: 1
              	CDSs: 2886
              		hypotheticals: 36
              		pseudogenes: 10
              		signal peptides: 0
              	sORFs: 4
              	gaps: 0
              	oriCs/oriVs: 4
              	oriTs: 0
              
              export annotation results to: /tmp/tmpl1obw4de/job_working_directory/000/11/working/bakta_output
              	human readable TSV...
              	GFF3...
              	INSDC GenBank & EMBL...
              	genome sequences...
              	feature nucleotide sequences...
              	translated CDS sequences...
              	circular genome plot...
              	hypothetical TSV...
              	translated hypothetical CDS sequences...
              	machine readable JSON...
              	genome and annotation summary...
              
              If you use these results please cite Bakta: https://doi.org/10.1099/mgen.0.000685
              Annotation successfully finished in 249:40 [mm:ss].
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              annotation {"complete": false, "compliant": false, "keep_contig_headers": false, "meta": false, "prodigal": null, "proteins": null, "regions": null, "replicons": null, "translation_table": "11"}
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              input_option {"amrfinder_db_select": "amrfinderplus_V3.12_2024-05-02.2", "bakta_db_select": "V5.0_2023-02-20", "input_file": {"values": [{"id": 19, "src": "hda"}]}, "min_contig_length": null}
              organism {"genus": null, "plasmid": null, "species": null, "strain": null}
              output_files {"output_selection": ["file_tsv", "file_gff3", "file_ffn", "file_plot", "file_gbff", "file_embl", "file_fna", "file_faa", "hypo_tsv", "hypo_fa", "file_json", "sum_txt"]}
              workflow {"skip_analysis": null}
      • Step 9: ToolDistillator:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • mkdir "tooldistillator_folder" &&  tooldistillator plasmidfinder --hid '12' '/tmp/tmpl1obw4de/files/c/2/d/dataset_c2de2e7c-665a-445b-9601-1043f28a98c3.dat' --analysis_software_version '2.1.6' --reference_database_version 'plasmidfinder_81c11f4_2023_12_04' --plasmid_result_tabular_path '/tmp/tmpl1obw4de/files/5/4/a/dataset_54a2929b-0ac6-4087-acc1-f2c53e496fa5.dat' --plasmid_result_tabular_hid '15' --genome_hit_path '/tmp/tmpl1obw4de/files/5/3/9/dataset_539c6859-9b65-403c-8227-2991c40201f9.dat' --genome_hit_hid '13' --plasmid_hit_path '/tmp/tmpl1obw4de/files/e/1/8/dataset_e18d215d-2f5f-4719-ab5d-9af1726499b5.dat' --plasmid_hit_hid '14' -o 'tooldistillator_folder/plasmidfinder_0_output.json' | tee 'XXXX' && tooldistillator isescan --hid '4' '/tmp/tmpl1obw4de/files/6/3/a/dataset_63ab0ecc-ed8b-4fcd-87ef-c2873bcc36ab.dat' --analysis_software_version '1.7.2.3' --reference_database_version '' --summary_path '/tmp/tmpl1obw4de/files/d/8/4/dataset_d845d04c-bd33-46ce-988f-b42ef21698d4.dat' --summary_hid '3' --annotation_path '/tmp/tmpl1obw4de/files/c/9/f/dataset_c9f5dc73-d950-488f-8da3-da85d232c59e.dat' --annotation_hid '5' --orf_fna_path '/tmp/tmpl1obw4de/files/9/e/4/dataset_9e4a13ba-5fd8-455d-8f3a-6d23e95804b1.dat' --orf_fna_hid '7' --orf_faa_path '/tmp/tmpl1obw4de/files/0/5/6/dataset_05689106-47b8-46ff-a61b-2488a066a174.dat' --orf_faa_hid '8' --is_fna_path '/tmp/tmpl1obw4de/files/a/1/1/dataset_a117b423-d116-4c9f-aeb1-3f32c397d203.dat' --is_fna_hid '6' -o 'tooldistillator_folder/isescan_1_output.json' | tee 'XXXX' && tooldistillator integronfinder2 --hid '10' '/tmp/tmpl1obw4de/files/d/8/7/dataset_d8782c17-7d24-4cb6-a837-fbe389fdc90d.dat' --analysis_software_version '2.0.5' --reference_database_version '' --summary_file_path '/tmp/tmpl1obw4de/files/f/e/6/dataset_fe621a87-acf7-456e-aa03-f7bf67489890.dat' --summary_file_hid '11' -o 'tooldistillator_folder/integronfinder2_2_output.json' | tee 'XXXX' && tooldistillator bakta --hid '27' '/tmp/tmpl1obw4de/files/2/3/5/dataset_2350201d-4db0-4549-a5d7-2741119b5390.dat' --analysis_software_version '1.9.4' --reference_database_version 'V5.0_2023-02-20' --annotation_tabular_path '/tmp/tmpl1obw4de/files/d/e/a/dataset_dea11696-be38-447a-9fa1-8dd4e5205b2b.dat' --annotation_tabular_hid '17' --annotation_genbank_path '/tmp/tmpl1obw4de/files/4/6/e/dataset_46e2eb09-1b29-4355-9c27-163ead2a1226.dat' --annotation_genbank_hid '19' --annotation_embl_path '/tmp/tmpl1obw4de/files/6/e/7/dataset_6e7f0a59-f89e-44a9-8b72-2de185c4d0e5.dat' --annotation_embl_hid '20' --contig_sequences_path '/tmp/tmpl1obw4de/files/f/6/9/dataset_f69d96a0-9a04-4377-b4f7-2897e58954ef.dat' --contig_sequences_hid '21' --nucleotide_annotation_path '/tmp/tmpl1obw4de/files/1/d/8/dataset_1d8c52c4-3fe2-4fe1-a62b-05cea359ad66.dat' --nucleotide_annotation_hid '22' --amino_acid_annotation_path '/tmp/tmpl1obw4de/files/8/e/f/dataset_8ef94866-d545-441f-99a8-ad20a539ecec.dat' --amino_acid_annotation_hid '23' --summary_result_path '/tmp/tmpl1obw4de/files/d/b/f/dataset_dbf8279d-4fbd-4130-ac3b-b1509c2fb5bf.dat' --summary_result_hid '26' --gff_file_path '/tmp/tmpl1obw4de/files/6/3/b/dataset_63b66695-ac0b-4c9d-b77b-91093db2d2f6.dat' --gff_file_hid '18' --hypothetical_protein_path '/tmp/tmpl1obw4de/files/d/a/8/dataset_da882925-cc65-47ba-951e-ec17a67e3947.dat' --hypothetical_protein_hid '25' --hypothetical_tabular_path '/tmp/tmpl1obw4de/files/2/8/8/dataset_2883fe13-b7f6-4872-ad63-eb860ce952f3.dat' --hypothetical_tabular_hid '24' --plot_file_path '/tmp/tmpl1obw4de/files/d/6/4/dataset_d6445af1-9fc7-4662-8ea9-b11f1e2335b4.dat' --plot_file_hid '28' -o 'tooldistillator_folder/bakta_3_output.json' | tee 'XXXX'

            Exit Code:

            • 0

            Standard Error:

            • 09/23/2024 11:49:23 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/c/2/d/dataset_c2de2e7c-665a-445b-9601-1043f28a98c3.dat
              09/23/2024 11:49:23 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/5/3/9/dataset_539c6859-9b65-403c-8227-2991c40201f9.dat
              09/23/2024 11:49:23 PM: plasmidfinderio.py: Analysis of genome_hit_path
              09/23/2024 11:49:23 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/e/1/8/dataset_e18d215d-2f5f-4719-ab5d-9af1726499b5.dat
              09/23/2024 11:49:23 PM: plasmidfinderio.py: Analysis of plasmid_hit_path
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/6/3/a/dataset_63ab0ecc-ed8b-4fcd-87ef-c2873bcc36ab.dat
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/9/e/4/dataset_9e4a13ba-5fd8-455d-8f3a-6d23e95804b1.dat
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/0/5/6/dataset_05689106-47b8-46ff-a61b-2488a066a174.dat
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/a/1/1/dataset_a117b423-d116-4c9f-aeb1-3f32c397d203.dat
              09/23/2024 11:49:25 PM: interfaces.py: Extraction of: summary_path
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/8/4/dataset_d845d04c-bd33-46ce-988f-b42ef21698d4.dat
              09/23/2024 11:49:25 PM: interfaces.py: Extraction of: annotation_path
              09/23/2024 11:49:25 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/c/9/f/dataset_c9f5dc73-d950-488f-8da3-da85d232c59e.dat
              09/23/2024 11:49:27 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/8/7/dataset_d8782c17-7d24-4cb6-a837-fbe389fdc90d.dat
              09/23/2024 11:49:27 PM: integronfinder2io.py: Analysis of summary_file_path
              09/23/2024 11:49:27 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/f/e/6/dataset_fe621a87-acf7-456e-aa03-f7bf67489890.dat
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/2/3/5/dataset_2350201d-4db0-4549-a5d7-2741119b5390.dat
              09/23/2024 11:49:29 PM: baktaio.py: bakta input file imported
              09/23/2024 11:49:29 PM: baktaio.py: summary_result_path analysis
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/b/f/dataset_dbf8279d-4fbd-4130-ac3b-b1509c2fb5bf.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: annotation_tabular_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/e/a/dataset_dea11696-be38-447a-9fa1-8dd4e5205b2b.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: gff_file_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/6/3/b/dataset_63b66695-ac0b-4c9d-b77b-91093db2d2f6.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: annotation_genbank_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/4/6/e/dataset_46e2eb09-1b29-4355-9c27-163ead2a1226.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: annotation_embl_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/6/e/7/dataset_6e7f0a59-f89e-44a9-8b72-2de185c4d0e5.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: contig_sequences_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/f/6/9/dataset_f69d96a0-9a04-4377-b4f7-2897e58954ef.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: nucleotide_annotation_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/1/d/8/dataset_1d8c52c4-3fe2-4fe1-a62b-05cea359ad66.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: amino_acid_annotation_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/8/e/f/dataset_8ef94866-d545-441f-99a8-ad20a539ecec.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: hypothetical_protein_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/a/8/dataset_da882925-cc65-47ba-951e-ec17a67e3947.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: hypothetical_tabular_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/2/8/8/dataset_2883fe13-b7f6-4872-ad63-eb860ce952f3.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: summary_result_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/b/f/dataset_dbf8279d-4fbd-4130-ac3b-b1509c2fb5bf.dat
              09/23/2024 11:49:29 PM: interfaces.py: Extraction of: plot_file_path
              09/23/2024 11:49:29 PM: interfaces.py: Treatment of /tmp/tmpl1obw4de/files/d/6/4/dataset_d6445af1-9fc7-4662-8ea9-b11f1e2335b4.dat
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
              log false
              tool_section {"tools": [{"__index__": 0, "select_tool": {"__current_case__": 14, "analysis_software_version": "2.1.6", "genome_hit_path": {"values": [{"id": 31, "src": "hda"}]}, "input": {"values": [{"id": 30, "src": "hda"}]}, "plasmid_hit_path": {"values": [{"id": 32, "src": "hda"}]}, "plasmid_result_tabular_path": {"values": [{"id": 33, "src": "hda"}]}, "reference_database_version": "plasmidfinder_81c11f4_2023_12_04", "tool_list": "plasmidfinder"}}, {"__index__": 1, "select_tool": {"__current_case__": 11, "analysis_software_version": "1.7.2.3", "annotation_path": {"values": [{"id": 23, "src": "hda"}]}, "input": {"values": [{"id": 22, "src": "hda"}]}, "is_fna_path": {"values": [{"id": 24, "src": "hda"}]}, "orf_faa_path": {"values": [{"id": 26, "src": "hda"}]}, "orf_fna_path": {"values": [{"id": 25, "src": "hda"}]}, "reference_database_version": null, "summary_path": {"values": [{"id": 21, "src": "hda"}]}, "tool_list": "isescan"}}, {"__index__": 2, "select_tool": {"__current_case__": 10, "analysis_software_version": "2.0.5", "input": {"values": [{"id": 28, "src": "hda"}]}, "reference_database_version": null, "summary_file_path": {"values": [{"id": 29, "src": "hda"}]}, "tool_list": "integronfinder2"}}, {"__index__": 3, "select_tool": {"__current_case__": 2, "amino_acid_annotation_path": {"values": [{"id": 41, "src": "hda"}]}, "analysis_software_version": "1.9.4", "annotation_embl_path": {"values": [{"id": 38, "src": "hda"}]}, "annotation_genbank_path": {"values": [{"id": 37, "src": "hda"}]}, "annotation_tabular_path": {"values": [{"id": 35, "src": "hda"}]}, "contig_sequences_path": {"values": [{"id": 39, "src": "hda"}]}, "gff_file_path": {"values": [{"id": 36, "src": "hda"}]}, "hypothetical_protein_path": {"values": [{"id": 43, "src": "hda"}]}, "hypothetical_tabular_path": {"values": [{"id": 42, "src": "hda"}]}, "input": {"values": [{"id": 45, "src": "hda"}]}, "nucleotide_annotation_path": {"values": [{"id": 40, "src": "hda"}]}, "plot_file_path": {"values": [{"id": 46, "src": "hda"}]}, "reference_database_version": "V5.0_2023-02-20", "summary_result_path": {"values": [{"id": 44, "src": "hda"}]}, "tool_list": "bakta"}}]}
      • Step 10: ToolDistillator summarize:

        • step_state: scheduled

        • Jobs
          • Job 1:

            • Job state is ok

            Command Line:

            • tooldistillator --version && mkdir -p input_files && cp '/tmp/tmpl1obw4de/files/8/a/c/dataset_8ac15cd1-8bdd-4513-8fe1-1808660c3e8a.dat' ./input_files/ && cp '/tmp/tmpl1obw4de/files/9/3/5/dataset_935e3455-5f42-4fe1-ad21-071ef49ea3b7.dat' ./input_files/ && cp '/tmp/tmpl1obw4de/files/7/8/8/dataset_78833735-73ea-4594-b86b-f9325b1742fa.dat' ./input_files/ && cp '/tmp/tmpl1obw4de/files/f/9/9/dataset_f99b3bec-8808-45d2-b87f-560cc22260b0.dat' ./input_files/ && tooldistillator summarize input_files/* -o summary.json

            Exit Code:

            • 0

            Standard Output:

            • tooldistillator 0.9
              

            Traceback:

            Job Parameters:

            • Job parameter Parameter value
              __input_ext "input"
              __workflow_invocation_uuid__ "5857872079e311efb46553e5001e451b"
              chromInfo "/tmp/tmpl1obw4de/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
              dbkey "?"
    • Other invocation details
      • history_id

        • ec8f804411135ae5
      • history_state

        • ok
      • invocation_id

        • ec8f804411135ae5
      • invocation_state

        • scheduled
      • workflow_id

        • ec8f804411135ae5

average_bigwigs:
class: Collection
collection_type: list
attributes:

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

What's the model behind this ? attributes seems kind of odd, shouldn't this nest directly under the output ?

Copy link
Copy Markdown
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

It should and I will implement that in follow ups but that is an enhancement - this version of the models just reflects what actually works with current planemo. I don't think anyone ever thought this through and so it is a pretty low-level mapping to the XML parsing outputs.

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Don't ask my why I put this test... I cannot remember.

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

(I think I am the only one to use this type of test)

Copy link
Copy Markdown
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

@lldelisle

Copy link
Copy Markdown
Contributor

All tests passing have been integrated into #531 .
For the failed tests,

asserts:
has_text:
text: "SuCOS_Score"
n: 4

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I think this will only test the last one, do you have a check for this?

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I don't think that's really checkable as that's a yaml language issue, we don't go that deep.

n: 8
tooldistillator_summarize:
assert:
asserts:

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

below there are multiple 'has_text' and only the last one will be tested, right?

Comment on lines +24 to +31
asserts:
has_line:
line: "$$$$"
n: 4
asserts:
has_text:
text: "SuCOS_Score"
n: 4

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Suggested change
asserts:
has_line:
line: "$$$$"
n: 4
asserts:
has_text:
text: "SuCOS_Score"
n: 4
asserts:
has_line:
line: "$$$$"
n: 4
has_text:
text: "SuCOS_Score"
n: 4

@lldelisle

Copy link
Copy Markdown
Contributor

@jmchilton or @mvdbeek would you mind to rebase with main and check if there are other issues to solve, please?

@jmchilton

Copy link
Copy Markdown
Member Author

Closing this - I think we've worked through this from different angles. If I'm missing anything - please yell and I'm sorry for all the noise.

@jmchilton jmchilton closed this Jul 16, 2026
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Labels

None yet

Projects

None yet

Development

Successfully merging this pull request may close these issues.

3 participants