Skip to content

tdido/wgs-practical

 
 

Repository files navigation

De novo assembly of Illumina reads using ABySS and alignment using BWA

This workshop is designed by Shaun Jackman @sjackman.

Purpose

We will use ABySS to assemble a 200 kbp bacterial artificial chromosome (BAC) using one lane of paired-end reads from the Illumina platform. BWA-MEM is used to align the assembled contigs to the human reference genome, and bcftools is used to call variants. IGV is used to visualize these alignments and variants. snpEff is used to determine the effects of these variants.

After this lab, you will have learned how to use ABySS to assemble a small genome, use BWA-MEM to align reads and contigs to a reference genome, use IGV to visualize these alignments, and use bcftools and snpEff to call variants and determine their effect.

Contents

Getting Started

System requirements

The total run time of the tools alone is approximately 70 minutes on a 2-core 2 GHz system. 4 GB of RAM and 5 GB of disk space is required. The following software is required:

Install Homebrew for Mac OS

Install Xcode.

Open Xcode, select "Xcode -> Preferences -> Downloads -> Command Line Tools -> Install".

Install Homebrew.

/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"

Install Linuxbrew for Linux

Install Linuxbrew.

ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Linuxbrew/install/master/install)"

Add the brew command to your PATH. You will need to run this command again in each new shell that you open.

PATH=~/.linuxbrew/bin:$PATH

Install the software using Homebrew or Linuxbrew

Install ABySS, bcftools, BWA, IGV, samtools and SnpEff using brew.

brew tap brewsci/bio
brew install abyss bcftools bwa gnuplot igv mummer samtools seqtk snpeff

Install the software on Ubuntu and Debian using apt-get

Install ABySS, bcftools, BWA, igv, and samtools.

sudo apt-get install abyss bcftools bwa igv samtools
sudo ln -s /usr/lib/abyss/abyss-fac /usr/local/bin/

Install the software manually

IGV may be installed using Java Web Start.

javaws http://www.broadinstitute.org/igv/projects/current/igv.jnlp

snpEff may be installed manually.

curl -LO http://downloads.sourceforge.net/project/snpeff/snpEff_v4_2_core.zip
unzip snpEff_v4_2_core.zip

Check that the software is installed

Check that the tools are installed in the PATH.

which abyss-fac abyss-pe bcftools bwa curl java samtools snpEff SnpSift

Download the data

Create your working directory.

mkdir ~/abyss
cd ~/abyss

Download the FASTQ files.

curl -LO http://www.bcgsc.ca/downloads/btl/sjackman/30CJCAAXX_4_1.fq.gz
curl -LO http://www.bcgsc.ca/downloads/btl/sjackman/30CJCAAXX_4_2.fq.gz

Download the reference file of human chromosome 3.

curl -LO http://hgdownload.cse.ucsc.edu/goldenpath/hg38/chromosomes/chr3.fa.gz
gunzip chr3.fa.gz

Install snpEff if you haven't yet, and download the snpEff database.

brew install snpeff
snpEff download GRCh38.86

Exercise 0: Index the reference using BWA

Index the reference file.

bwa index chr3.fa

8 min, 1 GB RAM, 260 MB disk space

Exercise 1: Align the reads to the reference using BWA (optional)

Run BWA.

bwa mem -t2 chr3.fa 30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz >30CJCAAXX_4.sam

40 min, 250 MB RAM, 3 GB disk space

While this job is running in the background, open a new terminal and continue with the next section.

Exercise 2: Inspect the reads

There are two FASTQ files for this one lane of paired-end Illumina data: one file for the forward reads and one file for the reverse reads. Look at the first few reads.

gunzip -c 30CJCAAXX_4_1.fq.gz | head

How long are the reads? (hint: use awk '{print length}')

gunzip -c 30CJCAAXX_4_1.fq.gz | awk '{print length}' | head -n2

50 bp

How many lines are there in both files? (hint: use wc -l)

gunzip -c 30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz | wc -l

40,869,448 lines

How many lines per read?

4 lines per read

How many reads are there in both files?

40869448 / 4 = 10,217,362 reads

How many bases are sequenced?

10217362 * 50 = 510,868,100 bp

Assuming the BAC is 200 kbp, what is the depth of coverage?

510868100 / 200000 = 2554 fold coverage

Exercise 3: Assemble the reads into contigs using ABySS

Run the assembly.

mkdir k48
ln -s ../30CJCAAXX_4_1.fq.gz ../30CJCAAXX_4_2.fq.gz k48/
abyss-pe -C k48 name=HS0674 k=48 s=200 v=-v in="30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz" contigs 2>&1 | tee abyss.log

You may need to use the uncompressed FASTQ files on a Mac.

gunzip -k 30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz
mkdir k48
ln -s ../30CJCAAXX_4_1.fq ../30CJCAAXX_4_2.fq k48/
abyss-pe -C k48 name=HS0674 k=48 s=200 v=-v in="30CJCAAXX_4_1.fq 30CJCAAXX_4_2.fq" contigs 2>&1 | tee abyss.log

5 min, 200 MB RAM, 2 MB disk space

Look at the option -n,--dry-run of abyss-pe. Its output is the commands that ABySS will run for the assembly.

abyss-pe name=HS0674 k=48 s=200 in="30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz" contigs -n

The assembly runs in three stages: assemble contigs without paired-end information, align the paired-end reads to the initial assembly, and merge contigs joined by paired-end information. You can instruct ABySS to stop after any of these stages. Use the -n option to see the commands for each stage.

abyss-pe name=HS0674 k=48 in="30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz" unitigs -n
abyss-pe name=HS0674 k=48 in="30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz" pe-sam -n
abyss-pe name=HS0674 k=48 in="30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz" contigs -n

Once the assembly has completed, look at the assembled contigs using less. The option -S disables line wrapping.

less -S k48/HS0674-contigs.fa

How many contigs are longer than 100 bp?

6

What is the length of the longest contig (hint: use awk '{print length}')?

awk '{print length}' k48/HS0674-contigs.fa | sort -n | tail -n1

67,526 bp

What is the N50 of the assembly?

abyss-fac k48/HS0674-contigs.fa
n   n:500  L50  min   N80    N50    N20    E-size  max    sum     name
13  6      2    8044  54373  54743  67480  51662   67480  212330  k48/HS0674-contigs.fa

54,743 bp

View the assembly log.

less -S abyss.log

What portion of the reads align to the assembly? (hint: search for "Mapped")

Mapped 7167472 of 10217362 reads (70.1%)

What is the median fragment size and standard deviation of this library? (hint: search for "median")

median = 204 bp, sd = 18 bp

Exercise 4: Align the contigs to the reference using web BLAT

Open BLAT in a web browser: http://genome.ucsc.edu

View the assembled contigs in a text editor. gview is one text editor. You can use any text editor that you prefer.

gview k48/HS0674-contigs.fa

Disable line wrap to make it easier to select the full sequence. For Emacs, select the option "Options -> Line Wrapping in this Buffer -> Truncate Long Lines." For Vim, select the option "Edit -> File Settings -> Toggle Line Wrap", or type :set nowrap

Select the two contigs whose lengths are approximately 8 and 16.5 kbp and copy-and-paste their sequence into BLAT.

What is the exact length of these two contigs?

8,044 bp and 16,561 bp

Click "browser" for the best alignment and then zoom out 10x. To which chromosome and band do these contigs align?

chr3q27.3

What are the nearest two genes?

SST and RTP2

Set the "Common SNPs" track in Variation to "pack".

A SNV between the assembled sequence and reference sequence is displayed with a red line. Zoom in on a SNV. Is it in dbSNP?

Zoom in on the gap between the two contigs. Set the "RepeatMasker" track in Repeats to "full". What feature overlaps the gap that likely caused the assembly gap?

Simple_repeat (TA)n

Zoom in to see the sequence of the feature.

Zoom out to see the alignment of both contigs. Unaligned query sequence is shown with a ridiculously thin purple line at the end of the alignment. The one-pixel-wide purple line is absurdly difficult to see. Which contig has unaligned sequence at one end?

the 16.5 kbp contig

Select that contig, and copy the unaligned sequence to the clipboard. Aligned sequence is shown in blue upper-case characters, and unaligned sequence is shown in black lower-case characters. Open BLAST in a web browser: http://blast.ncbi.nlm.nih.gov

Select "Nucleotide BLAST". Select the database "Nucleotide collection (nr/nt)". Paste the sequence into the query box. Click BLAST. Look at the first few best hits, and ignore hits to chimpanzee (Pan troglodytes) clones. What is the best alignment of our non-human contig fragment?

Cloning vector pTARBAC

What is the cause of this chimeric contig?

This assembled contig contains both the BAC cloning vector and the human DNA insert.

Exercise 5: Align the contigs to the reference using BWA-MEM

Warning: do not start BWA-MEM until BWA has completed unless your machine has at least 2 GB of RAM.

Run BWA-MEM.

bwa mem -t2 chr3.fa k48/HS0674-contigs.fa >k48/HS0674-contigs.sam
samtools sort -o k48/HS0674-contigs.bam k48/HS0674-contigs.sam
samtools index k48/HS0674-contigs.bam

1 min, 800 MB RAM, 1 MB disk space

Exercise 6: Browse the contig to reference alignments using samtools tview

Run samtools tview.

samtools tview k48/HS0674-contigs.bam chr3.fa

Go to the region chr3:186,931,150

g chr3:186,931,150

What variants do you see?

a T/G SNV and a 24-bp insertion

Go to the region chr3:186,958,940

g chr3:186,958,940

Notice the Ns in the contig sequence, indicating a scaffold gap. How many Ns are in the contig?

19 Ns

How many Ns should there be for the size of the gap to agree with the reference?

16 Ns

Exercise 7: Browse the contig to reference alignments using IGV

Start IGV. Open the "IGV 2.3" icon on your desktop, or run either igv or javaws http://www.broadinstitute.org/igv/projects/current/igv.jnlp at the command line.

Select "View -> Preferences -> Alignments" and change "Visibility range threshold (kb)" to 1000. Select the "Genomes -> Load Genome From Server -> Human hg38". Then select "File -> Load from File" and "k48/HS0674-contigs.bam" Go to the region chr3:186,500,000-188,000,000 by entering it into the box labeled "Go". IGV may take up to a minute to load.

Which four genes overlap the contigs?

ST6GAL1, SST, RTP2 and BCL6

Add the dbSNP track. Select "File -> Load from Server", expand "Annotations" and select "All Snps 1.4.2". Should you have issues loading it, select "common Snps 1.4.2" instead.

Alternatively, download ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/00-common_all.vcf.gz for Common Snps, or ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/00-All.vcf.gz for All Snps along with their associated .gz.tbi index file, and load them using "File -> Load from File".

Zoom in on a SNV. Is it in dbSNP? Is it coding?

Bonus: Find a coding SNV. What is its dbSNP rs ID?

rs1973791 (chr3:187,698,846) and rs11707167 (chr3:187,698,931) in the last exon of RTP2. (note that rs1973791 in only available when using "All Snps 1.4.2", so ignore it if you are using "common Snps 1.4.2"). rs1056932 (chr3:187,729,244) in exon 5 of BCL6.

Exercise 8: View the contig to reference alignments SAM file

View the SAM file.

less -S k48/HS0674-contigs.sam

The contig ID is given in the first column, and the position of the contig on the reference is given in the third and fourth columns. Which large contig has two alignments, and what are the positions of these two alignments?

The contig that has alignments starting at chr3:186,980,605 and chr3:187,722,004.

The orientation is given in the second column. The numbers 0 and 2048 both indicate positive orientation, and 16 indicates negative orientation. What is the position and orientation of these two alignments?

chr3:186,980,605 (-) and chr3:187,722,004 (+)

In IGV, go to the region chr3:186,500,000-188,000,000. Right click on one of the alignments and choose Link supplementary alignments. The two alignments connected by a thin line indicates that the alignment of this contig to the reference genome is split in two, suggesting a misassembly or a structural rearrangement. Because the orientations of the two alignments differ, part of the split alignment is highlighted in pink. Hover your cursor over the pink alignment and look at the Strands field in the pop up text.

What large-scale structural rearrangement has occurred, and what is its approximate size?

a ~700 kbp inversion

Which two genes are fused as a result of this rearrangement?

ST6GAL1 and BCL6

Create a dot plot using MUMmer

A dot plot visualizes the alignments of two sequences to each other.

Extract the two sequences that we want to align. In the commands below, replace the number 102 with the contig identifier of your contig that shows the inversion. Your contig may be reverse-complemented with respect to the reference, because the orientation of assembled contigs is arbitrary. The seqtk seq -r command below reverse complements the contig sequence. If your contig had the same orientation as the reference, you would want to skip that command.

samtools faidx chr3.fa chr3:186,900,000-187,800,000 >chr3q27.3.fa
samtools faidx k48/HS0674-contigs.fa 102 | seqtk seq -r >inversion.fa

Align the two sequences to each other using nucmer from MUMmer.

nucmer -p inversion chr3q27.3.fa inversion.fa >inversion.delta

Create the dot plot.

mummerplot -png -p inversion inversion.delta

Edit the file inversion.gp to make the aspect ratio square. Also disable the interactive mouse feature of gnuplot, which requires that you install X11. The following command uses sed to edit the file, but you could also use a text editor.

sed -i '' 's/set size 1,1/set size ratio -1/;/set mouse/d' inversion.gp
gnuplot inversion.gp

Open the image inversion.png. The size of the bacterial artificial chromosome (BAC) is much smaller than the size of the inversion, but even so we can still determine the size of the inversion. If you have pen and paper handy, draw what the dot plot would look like if the inversion were smaller so that the BAC contained the entire inversion. How large is the inversion?

approximately 700 kbp

Exercise 9: Call variants of the reads-to-reference alignments using bcftools (optional)

Check that BWA has completed aligning the reads to the reference, or run BWA now.

bwa mem -t2 chr3.fa 30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz >30CJCAAXX_4.sam

Call variants using bcftools.

samtools sort -@2 -o 30CJCAAXX_4.bam 30CJCAAXX_4.sam
samtools index 30CJCAAXX_4.bam
samtools mpileup -u -d 9999 -L 9999 -f chr3.fa 30CJCAAXX_4.bam >30CJCAAXX_4.bcf
bcftools call -c -v -Oz 30CJCAAXX_4.bcf >30CJCAAXX_4.vcf.gz
bcftools index 30CJCAAXX_4.vcf.gz

20 min, 250 MB RAM, 120 MB disk space

Exercise 10: Call variants of the contigs-to-reference alignments using bcftools

Run bcftools.

samtools mpileup -v -B -f chr3.fa k48/HS0674-contigs.bam | bcftools view -Oz -v snps,mnps,indels >k48/HS0674-contigs.vcf.gz
bcftools index k48/HS0674-contigs.vcf.gz

Browse the variants using IGV. Select "File -> Load from File" k48/HS0674-contigs.vcf.gz

Exercise 11: Determine the effects of the SNVs

Run SnpEff.

snpEff download GRCh38.86
snpEff eff GRCh38.82 k48/HS0674-contigs.vcf.gz >k48/HS0674-contigs.snpeff.vcf
SnpSift extractFields k48/HS0674-contigs.snpeff.vcf CHROM POS ANN >k48/HS0674-contigs.snpeff

1 min, 2.8 GB RAM

View the output of SnpEff.

less -S k48/HS0674-contigs.snpeff

Count the number of SNVs in each category of effect.

cut -d'|' -f2 k48/HS0674-contigs.snpeff | sort | uniq -c

Find all the coding (synonymous or missense) SNVs.

egrep 'synonymous|missense' k48/HS0674-contigs.snpeff | cut -f1,2

Find the missense (non-synonymous) SNV. What is its location?

chr3:187,698,931

What is its dbSNP rs ID? (hint: use IGV or the UCSC genome browser)

rs11707167

Open dbSNP in a web browser: http://www.ncbi.nlm.nih.gov/projects/SNP/

What is the minor allele frequency (MAF) of this SNP?

T=0.4002 (ExAC)

Exercise 12: Compare the assembly variants to the read-alignment variants (optional)

Browse the variants called by both methods using IGV.

Start IGV using either the command line or the user interface.

igv -g hg38 k48/HS0674-contigs.bam,k48/HS0674-contigs.vcf.gz,30CJCAAXX_4.vcf.gz

Or select:

  • File -> Load from File... k48/HS0674-contigs.bam
  • File -> Load from File... k48/HS0674-contigs.vcf.gz
  • File -> Load from File... 30CJCAAXX_4.vcf.gz

Go to the region chr3:186,931,150-186,931,250

Is the SNV called by both methods?

Yes.

Is the insertion called by both methods?

No, the insertion is called only by the assembly.

Hover the mouse cursor over the insertion to see the inserted sequence. What is the inserted sequence?

TCTGGGTTCCTTCAAATCCTGCCT

Compare the inserted sequence to the reference sequence at this location. What sequence do the inserted sequence and the reference sequence have in common?

The insertion duplicates the 8-bp sequence TCTGGGTT. The remaining 16 bp are an untemplated insertion.

Load the alignments of the reads to the reference. "File -> Load from File" 30CJCAAXX_4.bam

The aligned reads do not show the insertion, but the alignments that span the insertion have mismatches at the end of the alignment. Do those mismatched bases agree with the inserted sequence?

Yes, the mismatched bases show CT at the 5' end and CC at the 3' end, which agree with the inserted sequence.

Exercise 13: Align the reads to the contigs using BWA (optional)

Run BWA.

bwa index k48/HS0674-contigs.fa
bwa mem -t2 k48/HS0674-contigs.fa 30CJCAAXX_4_1.fq.gz 30CJCAAXX_4_2.fq.gz >k48/30CJCAAXX_4.sam
samtools sort -@2 -o k48/30CJCAAXX_4.bam k48/30CJCAAXX_4.sam
samtools index k48/30CJCAAXX_4.bam

12 min, 200 MB RAM, 3 GB disk space

Index the assembly FASTA file.

samtools faidx k48/HS0674-contigs.fa

Browse the BAM file using samtools tview.

samtools tview k48/30CJCAAXX_4.bam k48/HS0674-contigs.fa

Browse the BAM file using IGV.

Start IGV using either the command line or the user interface.

igv -g k48/HS0674-contigs.fa k48/30CJCAAXX_4.bam

Or select:

  • Genomes -> Load Genome from File k48/HS0674-contigs.fa
  • File -> Load from File k48/30CJCAAXX_4.bam

Find a scaffold gap on the largest contig. Find the two contigs that have consistent mate pairs joining them.

About

No description, website, or topics provided.

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • HTML 94.0%
  • Shell 5.3%
  • Other 0.7%