SLIM is a browser-based workflow builder for DNA metabarcoding and selected shotgun-metagenomics analyses. It wraps command-line bioinformatics tools in a graphical web interface so users can upload files, chain modules, run analyses, and download results without writing shell scripts.
The current repository is trtcrd/SLIM. The full manual starts at man/README.md.
SLIM provides:
- a Node.js web interface for configuring pipelines;
- a scheduler that runs modules inside a container;
- modules for demultiplexing or grouping samples manually, paired-end read merging, chimera removal, ASV/OTU inference, taxonomic assignment, filtering, and post-processing;
- long-read amplicon modules for Nanopore/PacBio workflows;
- optional shotgun metagenomics modules for taxonomic profiling using Kraken2-Bracken, mOTUs, and SingleM.
SLIM is maintained by Adrià Antich and Tristan Cordier.
Install and start either Podman or Docker before deploying SLIM. Podman is the default.
SLIM is a CPU-only container image. The dependency script downloads both Linux x86_64 and Linux aarch64 Miniforge installers, and the Dockerfile selects the matching installer at build time. Native builds are recommended on both x86_64 machines and ARM-based Macs running Linux ARM64 containers. Cross-building an x86_64 image on an ARM Mac may work through emulation, but it is expected to be much slower.
Download the latest stable archive:
sudo apt-get update
sudo apt-get install -y git curl
curl -OL https://github.com/trtcrd/SLIM/archive/v1.0.0.tar.gz
tar -xzvf v1.0.0.tar.gz
cd SLIM-1.0.0Then fetch bundled dependencies and build/start the container:
bash get_dependencies_slim_v1.0.0.sh
bash start_slim_v1.0.0.shget_dependencies_slim_v1.0.0.sh downloads third-party source archives and prepares local dependency folders. start_slim_v1.0.0.sh builds the image, stops/replaces any running SLIM container, removes dangling images, and starts the web server.
Restarting SLIM replaces the current container. Files uploaded to the previous container and analysis results stored there are removed.
Show all options:
bash start_slim_v1.0.0.sh --helpCommon options:
# Use Docker instead of Podman
bash start_slim_v1.0.0.sh --docker
# Expose SLIM on another host port
bash start_slim_v1.0.0.sh --port 8081:80
# Generate an ignored Caddyfile and bind SLIM locally for HTTPS
bash start_slim_v1.0.0.sh --caddy-domain slim.example.org
# Enable shotgun modules and download/mount their databases
bash start_slim_v1.0.0.sh --shotgun-databases
# Choose a Kraken2 database when shotgun modules are enabled
bash start_slim_v1.0.0.sh --shotgun-databases --kraken-db viralAvailable Kraken2 choices are viral, standard_8, standard_16, pluspf_8, and pluspf_16. The default is pluspf_16.
Email notifications are disabled unless a local slim_mail.env file exists at the root of the SLIM folder. For Gmail, enable 2-Step Verification and create an app password, then add:
SLIM_MAIL_USER=your.gmail.account@gmail.com
SLIM_MAIL_PASSWORD=your16digitapppassword
SLIM_MAIL_FROM=your.gmail.account@gmail.com
Do not commit slim_mail.env.
Shotgun databases are large and are kept outside the Docker image. By default, SLIM starts without downloading or mounting Kraken2-Bracken, SingleM, or mOTUs databases, and those modules are hidden from the module list.
Start with --shotgun-databases to download/mount the databases and expose the modules:
bash start_slim_v1.0.0.sh --shotgun-databasesManual download helpers are also available after the SLIM image exists:
./download_kraken2_db.sh pluspf_16
./download_motus_db.shDatabase locations:
- Kraken2:
lib/kraken2/db/ - mOTUs:
lib/mOTUs/db/ - SingleM:
lib/singleM/db/
By default, SLIM listens on host port 8080.
- Local machine:
http://localhost:8080/ - Remote server:
http://<server-ip>:8080/
After the first page load, SLIM adds a session token to the URL. If a Gmail emailing service is configured, you will receive an email with a direct link to your job; otherwise, bookmark the tokenized URL to return to the same session while it remains available.
The easiest production setup is to give the server a DNS name and put a small HTTPS reverse proxy in front of SLIM. Caddy is a good fit because it can request and renew free TLS certificates automatically.
- Create or buy a DNS name, for example
slim.example.org. - Point the DNS
Arecord to the public IPv4 address of the SLIM server. Add anAAAArecord too if the server has public IPv6. - Open ports
80/tcpand443/tcpon the server firewall. Start SLIM with the DNS name:
bash start_slim_v1.0.0.sh --caddy-domain slim.example.orgThis writes deployment/Caddyfile, keeps it out of version control, and binds SLIM to 127.0.0.1:8080 so plain HTTP is not exposed publicly. The generated Caddyfile looks like:
slim.example.org {
reverse_proxy 127.0.0.1:8080
}
- Install Caddy on the host server, copy the generated
deployment/Caddyfileto the Caddy configuration path, and reload Caddy. Do not put the generated Caddyfile in git; deployment/Caddyfile.example is only a committed template.
sudo cp deployment/Caddyfile /etc/caddy/Caddyfile
sudo caddy fmt --overwrite /etc/caddy/Caddyfile
sudo systemctl reload caddy
sudo systemctl status caddyAfter Caddy is running, users should access SLIM at https://slim.example.org/. The internal http://127.0.0.1:8080/ address is only used by Caddy on the server.
If http://slim.example.org/ shows nothing, Caddy is not reachable on public port 80. Check that Caddy is installed/running and that the server firewall, cloud security group, or router forwards ports 80 and 443 to the SLIM server.
If http://slim.example.org:8080/ works but Chrome says the site is not secure, you are bypassing Caddy and reaching the SLIM container directly. Reload Caddy, make sure ports 80 and 443 are open, and use https://slim.example.org/ without :8080.
Typical metabarcoding inputs include:
- paired-end FASTQ files for each multiplexed sequencing library;
- a tag-to-sample CSV describing library, sample, forward tag, and reverse tag;
- a primer FASTA file;
- a reference FASTA database for taxonomic assignment;
- or already-demultiplexed FASTQ files for direct per-sample workflows.
Toy datasets:
The tag-to-sample CSV must contain at least run, sample, forward, and reverse columns. Sample names must be unique, including replicates sequenced in multiple libraries.
run,sample,forward,reverse
library_1,sample_1,forwardPrimer-A,reversePrimer-B
library_1,sample_2,forwardPrimer-B,reversePrimer-C
library_2,sample_3,forwardPrimer-A,reversePrimer-B
library_2,sample_4,forwardPrimer-B,reversePrimer-CPrimer FASTA records must use unique identifiers. Primer sequences may contain IUPAC ambiguity codes.
>forwardPrimer-A
ACCTGCCTAGCGTYG
>forwardPrimer-B
GAATGCCTAGCGTYG
>reversePrimer-B
GAATCTYCAAATCGG
>reversePrimer-C
ACTACTYCAAATCGG
Reference FASTA headers must contain a unique identifier, one space, and a semicolon-separated taxonomy path with the same number of ranks for every record.
>AB353770 Eukaryota;Alveolata;Dinophyta;Dinophyceae;Dinophyceae_X;Dinophyceae_XX;Peridiniopsis;Peridiniopsis_kevei
ATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTTTTACATGGCGAAACTGCGAATGGCTCATTAAAACAG
>KC672520 Eukaryota;Opisthokonta;Fungi;Ascomycota;Pezizomycotina;Leotiomycetes;Leotiomycetes_X;Leotiomycetes_X_sp.
TACCTGGTTGATTCTGCCCCTATTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAA
>AB284159 Eukaryota;Alveolata;Dinophyta;Dinophyceae;Dinophyceae_X;Dinophyceae_XX;Protoperidinium;Protoperidinium_bipes
TGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTTCAACATGGCAAGACTGTGAATGGC
Common sources include SILVA, EUKREF, PR2, UNITE, and MIDORI.
Use Add a new module to select modules and chain them in order. Each module consumes uploaded files or files created by earlier modules.
For a typical metabarcoding workflow:
- Demultiplex libraries, unless each file already corresponds to one sample.
- Merge paired-end reads.
- Remove chimeras.
- Infer ASVs or cluster OTUs.
- Assign taxonomy.
- Filter or post-process the ASV/OTU table.
For already-demultiplexed data, use wildcard creator to create file groups that can pass through downstream modules.
The pipeline can be saved with Save and restored with Load. When a job starts, SLIM writes a pipeline.conf file recording the selected modules and parameters.
Use Secure uploaded data to preserve the initial uploaded files in a new tokenized SLIM page. This is useful when a long upload has completed but a queued, running, or aborted pipeline needs to be restarted with a fresh configuration.
SLIM asks for a job title and email address before securing the files. The secured page uses the job title, receives a new tokenized URL, and is excluded from automatic housekeeping. If email notifications are configured, SLIM sends the secured link to the provided address; otherwise, the link is shown directly in the interface.
Secured uploaded data remains on the server until the user explicitly removes it with Delete secured data on the secured page. This protects the original input files, not intermediate or result files from failed analyses.
SLIM uses wildcard patterns to pass groups of files between modules. For example:
sample*_R1.fastq
sample*_R2.fastq
Wildcards are generated by modules such as the demultiplexer or wildcard-creator. Select suggested wildcards from the autocompletion list instead of typing new wildcard expressions manually.
The integrated shotgun profilers are:
- Kraken2-Bracken: fast k-mer/minimizer classification followed by Bracken abundance estimation.
- mOTUs: marker-gene profiling for prokaryotic communities.
- SingleM: single-copy-marker profiling, mainly for bacterial and archaeal shotgun metagenomes.
For general exploratory shotgun data, kraken2-bracken is usually the fastest first screen. For marker-gene-based microbial profiling, compare mOTUs and SingleM.
Experimental ancient-DNA modules are included in the codebase but are not exposed in the default module list.
| Feature | Kraken2-Bracken | mOTUs | singleM |
|---|---|---|---|
| Primary method | k-mer/minimizer matching against a whole-genome database. | Nucleotide mapping to universal marker genes. | Protein-space search against conserved single-copy marker genes. |
| Main output unit | Bracken-estimated read counts and relative abundance at one selected taxonomic rank. | Marker-gene-normalized mOTU abundance profiles. | Marker-gene OTU/profile outputs and relative-abundance summaries. |
| Database dependence | Very dependent on the chosen Kraken2 database. Reads without sufficient database evidence remain unclassified or are assigned conservatively higher in the taxonomy. | Less dependent on exact whole-genome matches, but still limited to marker genes represented in the mOTUs database. | Designed to detect microbial marker-gene lineages, including novel OTUs, but mainly for bacteria and archaea with the default metapackage. |
| Best used for | Fast broad screening, especially with PlusPF databases for bacteria, archaea, viruses, plasmids, human, protozoa, and fungi. | Prokaryotic species-level or mOTU-level profiling when marker-gene precision is preferred over broad whole-genome screening. | Bacterial/archaeal community profiling and microbial novelty estimates from conserved marker genes. |
| Important limitations | Results follow the database content. PlusPF does not include plants by default; use a custom database for other targets. Bracken requires database files built for the selected read length. | Requires enough marker-gene signal and can be memory intensive because mOTUs v4 maps with BWA against a large marker database. | Not intended as a broad eukaryotic, fungal, viral, or plasmid classifier with the default SLIM metapackage. |
When the job finishes, download icons appear next to module outputs. Uploaded, intermediate, and result files remain available in the session for a limited time.
Module statuses:
waiting: the module is waiting for required input files;running: the module is executing;warnings: the module reported warnings but is still running;aborted: the module failed and the pipeline stopped;ended: the module finished successfully.
SLIM currently uses up to 8 CPU cores per module run. This value is set in server/scheduler.js:
const CORES_BY_RUN = 8;The number of concurrent jobs depends on available CPU cores and the scheduler (1-8 -> 1 job, 16 -> 2 jobs, etc.).
To add a module, see:
- Updated version of most dependencies.
- Updated Dockerfile and bash scripts for better handling of dependencies and for x86_64 and ARM64 container builds.
- Added a server status monitoring widget (CPU+RAM usage, queue position, and a message will show up if the server has crashed).
- Added an option to secure uploaded files of a session, allowing to re-use the data in a new session.
- Restored optional email notifications through Gmail app-password configuration.
- Added a widget to pick suggested pipelines for Illumina, Nanopore and PacBio amplicon data.
- Improved/fix the wildcard-creation module.
- Nanopore-oriented modules: lighten the installation of MSI, integrated a module based on isONclust3-minimap2-racon.
- PacBio-oriented modules: isONclust3.
- Added optional shotgun modules for Kraken2-Bracken, mOTUs, and SingleM.
- Fixed multiple interface and deployment issues.
- Moved to podman container by default (docker kept as an option)
- Added modules for processing nanopore amplicon data (CHOPPER, MSI, ASHURE, OPTICS)
- Added module to create wildcard grouping of files
- Added SWARM3 module
- Emailing service hidden, until a viable option is identified
- Documentation moved from the wiki to the tutos folder.
- Various interface bug fixes
Dockerfile: updated systeminformation and docker recipe
Dockerfile: updated to DADA2 v1.16 and DECIPHER v2.16.0, cleaned the docker recipe
BUGFIX: resolved issues with the order of module execution when DADA2 is used. BUGFIX: resolved issues with the pipeline.conf file that did not included the checkbox and radio buttons.
DTD: added an option for trimming the primers at the end of the reads in (for fully overlapping pair-end reads) and a contig length filtering
DADA2 beta integration, small fix on IDATAXA
BUGFIX of the IDTAXA module, added wiki for the module
Integration of the IDTAXA module
Fixed the Dockerfile to fetch the latest R version and CASPER util.c file
Added timing checkpoints in the logs of the scheduler; Added the third-party software version infos in the email
Fixed LULU module and the otu table writing is now done by a python script
Updated the get_dependencies script.
First release, with third-parties versions handled within the get_dependencies_slim.sh script.
